US11597912B2ActiveUtilityA1
Method of producing regulatory T cells by culturing regulatory T cells obtained from umbilical cord blood
Est. expiryApr 2, 2041(~14.6 yrs left)· nominal 20-yr term from priority
C12N 2501/04C12N 2501/15A61P 37/06A61K 35/17C12N 5/0637C12N 2500/40C12N 2501/2302
52
PatentIndex Score
0
Cited by
16
References
5
Claims
Abstract
The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.
Claims
exact text as granted — not AI-modifiedWhat is claimed is:
1. A method for producing a population of regulatory T cells comprising:
culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide of SEQ ID NO. 1 to expand the initial population of regulatory T cells.
2. The method of claim 1 , wherein the media further comprises TGFβ1.
3. The method of claim 1 , wherein the media further comprises rapamycin.
4. The method of claim 1 , wherein the media further comprises TGFβ1 and rapamycin.
5. The method of claim 1 , wherein the initial population of regulatory T cells has been enriched for CD4 + CD25 +/hi CD127 lo/− FoxP3 + .Join the waitlist — get patent alerts
Track US11597912B2 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.