US12018272B2ActiveUtilityA1
RNA-guided human genome engineering
Est. expiryDec 17, 2032(~6.4 yrs left)· nominal 20-yr term from priority
C12N 15/11C12N 15/79C12N 15/113C12N 5/10C12N 15/85A61K 48/00C12N 2800/80C12Y 301/00C12N 9/22C12N 15/1024C12N 2810/55C12N 15/907C12N 15/87C12N 15/8201C12N 15/81C12N 15/01C12N 15/90C12N 15/63C12N 15/102C12N 2310/20C12N 15/10
98
PatentIndex Score
2
Cited by
246
References
17
Claims
Abstract
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
Claims
exact text as granted — not AI-modifiedThe invention claimed is:
1. An ex vivo human cell comprising:
a Cas9 protein complexed with an RNA,
wherein the RNA comprises the sequence
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGC.
2. The ex vivo human cell of claim 1 , wherein the Cas9 protein is an S. pyogenes Cas9 protein.
3. The ex vivo human cell of claim 1 , wherein the RNA is about 100 nucleotides in length.
4. The ex vivo human cell of claim 1 , wherein the RNA is complementary to a target nucleic acid sequence within the ex vivo human cell.
5. The ex vivo human cell of claim 4 , wherein the RNA is hybridized to the target nucleic acid sequence in the ex vivo human cell.
6. The ex vivo human cell of claim 1 , wherein the RNA has a secondary structure comprising a first hairpin and a second 3′ hairpin.
7. An ex vivo human cell comprising:
a Cas9 protein complexed with an RNA,
wherein the RNA comprises the sequence
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGC,
and
wherein the Cas9 protein bears an SV40 nuclear localization signal.
8. The ex vivo human cell of claim 7 , wherein the SV40 nuclear localization signal is at a C-terminus of the Cas9 protein.
9. The ex vivo human cell of claim 7 , wherein the Cas9 protein is an S. pyogenes Cas9 protein.
10. The ex vivo human cell of claim 7 , wherein the RNA is about 100 nucleotides in length.
11. The ex vivo human cell of claim 7 , wherein the RNA is complementary to a target nucleic acid sequence within the ex vivo human cell.
12. The ex vivo human cell of claim 11 , wherein the RNA is hybridized to the target nucleic acid sequence in the ex vivo human cell.
13. The ex vivo human cell of claim 7 , wherein the RNA has a secondary structure comprising a first hairpin and a second 3′ hairpin.
14. An ex vivo human cell comprising:
a Cas9 protein complexed with an RNA,
wherein:
the RNA comprises the sequence
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGC,
and
the RNA is at least 100 nucleotides in length.
15. The ex vivo human cell of claim 14 , wherein the RNA is complementary to a target nucleic acid sequence within the ex vivo human cell.
16. An ex vivo human cell comprising:
an S. pyogenes Cas9 protein complexed with an RNA,
wherein:
the RNA comprises the sequence
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC
UUGAAAAAGUGGCACCGAGUCGGUGC,
the RNA is at least 100 nucleotides in length, and
the S. pyogenes Cas9 protein bears a SV40 nuclear localization signal at a C-terminus of the S. pyogenes Cas9 protein.
17. The ex vivo human cell of claim 16 , wherein the RNA is complementary to a target nucleic acid sequence within the ex vivo human cell.Cited by (0)
No later patents cite this yet.
References (0)
No backward citations on record.