US2002102540A1PendingUtilityA1

Functional dna clone for hepatitis c virus (hcv) and uses thereof

32
Priority: Mar 4, 1997Filed: Jan 26, 1999Published: Aug 1, 2002
Est. expiryMar 4, 2017(expired)· nominal 20-yr term from priority
A61P 31/20A61P 35/00A61P 31/12A61P 31/14A61P 31/00C12N 15/86C07K 14/005C12Q 1/707A61K 48/00C12N 2770/24221C12N 2770/24234A61K 39/29C07K 2319/00A61K 38/00A61P 1/00A61K 2039/51A61K 2039/525C12N 2840/206C12N 2770/24222A61K 39/12C12N 2840/203C12N 7/00A61P 1/16A61K 39/00
32
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The present invention relates to the determination of an authentic HCV genome RNA sequences, to construction of infectious HCV DNA clones, and to use of the clones, or their derivatives, in therapeutic, vaccine, and diagnostic applications. The invention is also directed to HCV vectors, e.g., for gene therapy of gene vaccines.

Claims

exact text as granted — not AI-modified
What is claimed is:  
     
         1 . A genetically engineered hepatitis C virus (HCV) nucleic acid clone which comprises from 5′ to 3′ on the positive-sense nucleic acid a functional 5′ non-translated region (NTR) comprising an extreme 5′-terminal conserved sequence, an open reading frame (ORF) encoding at least a portion of an HCV polyprotein whose cleavage products form functional components of HCV virus particles and RNA replication machinery, and a 3′ non-translated region (NTR) comprising an extreme 3′-terminal conserved sequence, or a derivative thereof selected from the group consisting of adapted virus, live-attenuated virus, replication-competent non-infectious virus, and defective virus.  
     
     
         2 . The HCV nucleic acid of  claim 1  which has a consensus nucleic acid sequence determined from the sequence of a majority of at least three clones of an HCV isolate or genotype.  
     
     
         3 . The HCV nucleic acid of  claim 2  having at least a functional portion of a sequence as shown in SEQ ID NO:1.  
     
     
         4 . The HCV nucleic acid of  claim 1  or  3 , wherein a region from an HCV isolate is substituted for a homologous region.  
     
     
         5 . The HCV nucleic acid of  claim 1  which is a DNA that codes on expression for a replication-competent HCV RNA replicon, or which is a replication-competent HCV RNA replicon.  
     
     
         6 . An HCV nucleic acid of  claim 1 ,  3 , or  5  which has the full length sequence as depicted in or corresponding to SEQ ID NO:1.  
     
     
         7 . The HCV nucleic acid of  claim 1  wherein the 5′-terminal sequence is homologous or complementary to an RNA sequence selected from the group consisting of GCCAGCC;GGCCAGCC;UGCCAGCC;AGCCAGCC;AAGCCAGCC; GAGCCAGCC; GUGCCAGCC; and GCGCCAGCC, wherein the sequence GCCAGCC is the 5′-terminus of SEQ ID NO:3.  
     
     
         8 . The HCV nucleic acid of  claim 1  wherein the 3′-NTR extreme terminus is homologous or complementary to a DNA having the sequence  
       
         
           
                 
                 
               
                     
                 
                   5′-GGTGGCTCCATCTTAGCCCTAGTCACGGCTAG 
                   (SEQ ID NO:4). 
                 
                     
                 
                   CTGTGAAAGGTCCGTGAGCCGCATGACTGCAGAGA 
                 
                     
                 
                   GTGCTGATACTGGCCTCTCTGCTGATCATGT-3′ 
                 
                     
                 
             
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         9 . The HCV nucleic acid of  claim 1  wherein the 3′-NTR comprises a long poly-pyrimidine region.  
     
     
         10 . The HCV nucleic acid of  claim 1 ,  3 , or  5  further comprising a heterologous gene operatively associated with an expression control sequence, wherein the heterologous gene and expression control sequence are oriented on the positive-strand nucleic acid molecule.  
     
     
         11 . The HCV nucleic acid of  claim 10  wherein the heterologous gene is inserted by a strategy selected from the group consisting of: 
 a) in-frame fusion with the HCV polyprotein coding sequence; and  
 b) creation of an additional cistron.  
 
     
     
         12 . The HCV nucleic acid of  claim 10 , wherein the heterologous gene is an antibiotic resistance gene or a reporter gene.  
     
     
         13 . The HCV nucleic acid of  claim 11 , wherein the antibiotic resistance gene is a neomycin resistance gene operatively associated with an internal ribosome entry site (IRES) inserted in an SfiI site in the 3′-NTR.  
     
     
         14 . The HCV nucleic acid of  claim 1 ,  3 , or  5  which is selected from the group consisting of double stranded DNA, positive-sense cDNA, or negative-sense cDNA.  
     
     
         15 . The HCV nucleic acid of  claim 1 ,  3 , or  5  which is positive-sense RNA or negative-sense RNA.  
     
     
         16 . The HCV DNA of  claim 14  further comprising a promoter 5′ of the 5′-NTR on positive-sense DNA, whereby transcription of template DNA from the promoter produces replication-competent RNA.  
     
     
         17 . A plasmid clone harboring a full-length HCV cDNA which can be transcribed to produce infectious HCV RNA transcripts as deposited with the American Type Culture Collection and assigned accession no. 97879, having a sequence as depicted in SEQ ID NO:5, or a derivative thereof selected from the group consisting of 
 a) a derivative wherein a 5′-terminal sequence is homologous or complementary to an RNA sequence selected from the group consisting of GCCAGCC,GGCCAGCC,UGCCAGCC,AGCCAGCC,AAGCCAGCC, GAGCCAGCC, GUGCCAGCC, and GCGCCAGCC, wherein the sequence GCCAGCC is the 5′-terminus of SEQ ID NO:3; and    b) a derivative wherein a 3 ′-NTR comprises a short poly-pyrimidine region.    
     
     
         18 . A plasmid clone harboring a full-length HCV cDNA which can be transcribed to produce infectious HCV RNA transcripts as deposited with the American Type Culture Collection and assigned accession no. 97879, having a sequence as depicted in SEQ ID NO:5, or a derivative thereof selected from the group consisting of 
 a) a derivative produced by substitution of homologous regions from other HCV isolates or genotypes;    b) a derivative produced by mutagenesis;    c) a derivative selected from the group consisting of adapted, live-attenuated, replication competent non-infectious, and defective variants;    d) a derivative comprising a heterologous gene operatively associated with an expression control sequence;    e) a derivative consisting of a functional fragment of any of the abovementioned derivatives.    
     
     
         19 . An HCV DNA or RNA transcribed from the full length HCV cDNA harbored in the plasmid clone of  claim 17  or  18 .  
     
     
         20 . A method for identifying a cell line that is permissive for infection with HCV, comprising contacting a cell line in tissue culture with an infectious amount of the HCV RNA of  claim 15 , and detecting replication of HCV in cells of the cell line.  
     
     
         21 . A method for identifying a cell line that is permissive for infection with HCV, comprising contacting a cell line in tissue culture with an infectious amount of an infectious HCV RNA of  claim 19  under conditions that select for cells that express the heterologous expression control sequence.  
     
     
         22 . A method for identifying an animal that is permissive for infection with HCV, comprising introducing an infectious amount of the HCV RNA of  claim 15  to the animal, and detecting replication of HCV in the animal.  
     
     
         23 . A method for selecting for HCV with adaptive mutations that permit higher levels of HCV replication in a permissive cell line comprising contacting a cell line in culture with an infectious amount of the HCV RNA of  claim 15 , and detecting progressively increasing levels of HCV RNA in the cell line.  
     
     
         24 . The method according to  claim 23 , wherein the adaptive mutation permits modification of HCV tropism.  
     
     
         25 . A host cell line transfected, transformed, or transduced with the HCV DNA of  claim 16 .  
     
     
         26 . The host cell line of  claim 25  selected from the group consisting of a bacterial cell, a yeast cell, a plant cell, an insect cell, and a mammalian cell.  
     
     
         27 . A method for infecting an animal with HCV which comprises administering an infectious dose of HCV RNA of  claim 15  to the animal.  
     
     
         28 . A method for infecting an animal with HCV which comprises administering an infectious dose of HCV RNA of  claim 19  to the animal.  
     
     
         29 . A non-human animal infected with HCV, wherein the HCV has a genomic RNA sequence corresponding to the HCV nucleic acid of  claim 1 ,  3 , or  5 .  
     
     
         30 . A method for propagating HCV in vitro compris ing culturing a cell line contacted with an infectious amount of HCV RNA of  claim 15  under conditions that permit replication of the HCV RNA.  
     
     
         31 . A method for propagating HCV in vitro comprising culturing a cell line contacted with an infectious amount of HCV RNA of  claim 19  under conditions that permit replication of the HCV RNA.  
     
     
         32 . An in vitro cell line infected with HCV, wherein the HCV has a genomic RNA sequence corresponding to the HCV nucleic acid of  claim 1 ,  3 , or  5 .  
     
     
         33 . The cell line of  claim 32  which is a hepatocyte cell line.  
     
     
         34 . A method for transducing an animal susceptible to HCV infection with a heterologous gene, comprising administering an amount of the HCV nucleic acid of  claim 10  to the animal effective to infect the animal with the HCV.  
     
     
         35 . A method for transducing an animal susceptible to HCV infection with a heterologous gene, comprising administering an amount of the HCV RNA of  claim 19  to the animal effective to infect the animal with the HCV RNA.  
     
     
         36 . A method for producing HCV virus particles comprising isolating HCV virus particles from the HCV-infected non-human animal of  claim 29 .  
     
     
         37 . A method for producing HCV virus particles comprising: 
 a) culturing the cell line of  claim 25  under conditions that permit HCV replication and virus particle formation; and    b) isolating HCV virus particles from the cell line culture.    
     
     
         38 . A method for producing HCV virus particles comprising: 
 a) culturing the cell line of  claim 32  under conditions that permit HCV replication and virus particle formation; and    b) isolating HCV virus particles from the cell line culture.    
     
     
         39 . A method for producing HCV particle proteins comprising: 
 a) culturing a host expression cell line transfected with the HCV DNA of  claim 16  under conditions that permit expression of HCV particle proteins; and    b) isolating HCV particle proteins from the cell culture.    
     
     
         40 . An HCV virus particle comprising a replication-competent HCV genome RNA corresponding to the HCV nucleic acid of  claim 1 ,  3 , or  5 .  
     
     
         41 . An HCV virus particle comprising a replication-defective HCV genome RNA corresponding to the HCV nucleic acid of  claim 1 ,  3 , or  5 .  
     
     
         42 . An in vitro cell-free assay system for HCV comprising HCV genomic template RNA of  claim 15 , functional HCV replicase components, and an isotonic buffered medium comprising ribonucleotide triphosphate bases.  
     
     
         43 . An in vitro cell-free assay system for HCV comprising HCV genomic template RNA of  claim 19 , functional HCV replicase components, and an isotonic buffered medium comprising ribonucleotide triphosphate bases.  
     
     
         44 . A method for producing antibodies to HCV comprising administering an immunogenic amount of HCV virus particles of  claim 41  to an animal, and isolating anti-HCV antibodies from the animal.  
     
     
         45 . A method for producing antibodies to HCV comprising administering an immunogenic amount of HCV virus particles of  claim 42  to an animal, and isolating anti-HCV antibodies from the animal.  
     
     
         46 . A method for producing antibodies to HCV comprising screening a human antibody library for reactivity with HCV virus particles of  claim 41  and selecting a clone from the library that expresses an antibody reactive with the HCV virus particle.  
     
     
         47 . A method for producing antibodies to HCV comprising screening a human antibody library for reactivity with HCV virus particles of  claim 42  and selecting a clone from the library that expresses an antibody reactive with the HCV virus particle.  
     
     
         48 . An HCV vaccine comprising HCV virus particles of  claim 41  in a pharmaceutically acceptable adjuvant.  
     
     
         49 . An HCV vaccine comprising HCV virus particles of  claim 42  in a pharmaceutically acceptable adjuvant.  
     
     
         50 . A method for screening for agents capable of modulating HCV replication comprising: 
 a) administering a candidate agent to an HCV infected animal of claim  29 ; and    b) testing for an increase or decrease in a level of HCV infection or activity compared to a level of HCV infection or activity in the animal prior to administration of the candidate agent;    wherein a decrease in the level of HCV infection or activity compared to the level of HCV infection or activity in the animal prior to administration of the candidate agent is indicative of the ability of the agent to inhibit HCV infection or activity.    
     
     
         51 . The method according to  claim 47  wherein testing for the level of HCV infection is selected from the group consisting of: 
 a) measuring viral titer in a tissue sample from the animal;  
 b) measuring viral proteins in a tissue sample from the animal; and  
 c) measuring liver enzymes.  
 
     
     
         52 . The method according to  claim 50  wherein the HCV genome used to infect the animal includes a heterologous gene operatively associated with an expression control sequence, wherein the heterologous gene and expression control sequence are oriented on the positive-strand nucleic acid molecule, and wherein testing for the level of HCV activity comprises measuring the level of a marker protein in a tissue sample from the animal.  
     
     
         53 . A method for screening for agents capable of modulating HCV replication comprising: 
 a) contacting the cell line of  claim 32  with a candidate agent; and    b) testing for an increase or decrease in a level of HCV infection or activity compared to a level of HCV infection or activity in a control cell line or in the cell line prior to administration of the candidate agent;    wherein a decrease in the level of HCV infection or activity compared to the level of HCV infection or activity in a control cell line or in the cell line prior to administration of the candidate agent is indicative of the ability of the agent to inhibit HCV infection or activity.    
     
     
         54 . The method according to  claim 53  wherein testing for the level of HCV infection is selected from the group consisting of: 
 a) measuring viral titer in the cells, culture medium, or both; and  
 b) measuring viral proteins in the cells, culture medium, or both.  
 
     
     
         55 . The method according to  claim 53  wherein the HCV genome used to infect the cell line includes a heterologous gene operatively associated with an expression control sequence, wherein the heterologous gene and expression control sequence are oriented on the positive-strand nucleic acid molecule, and wherein testing for the level of HCV activity comprises measuring the level of a marker protein in a tissue sample from the animal.  
     
     
         56 . A method for screening for agents capable of modulating HCV replication comprising: 
 a) contacting the in vitro system of  claim 43  with a candidate agent; and    b) testing for an increase or decrease in a level of HCV replication compared to a level of HCV replication in a control cell system or system prior to administration of the candidate agent;    wherein a decrease in the level of HCV replication compared to the level of HCV replication in a control cell line or in the cell line prior to administration of the candidate agent is indicative of the ability of the agent to inhibit HCV infection or activity.    
     
     
         57 . A method for preparing an HCV nucleic acid comprising joining from 5′ to 3′ on the positive-sense DNA a functional 5′ non-translated region (NTR) comprising an extreme 5′-terminal conserved sequence, a polyprotein coding region encoding HCV proteins that provide for expression of functional HCV proteins, and a 3′ non-translated region (NTR) comprising an extreme 3′-terminal conserved sequence.  
     
     
         58 . The method according to  claim 56  further comprising determining a consensus sequence for the 5′-NTR, polyprotein coding sequence, and 3′-NTR from a majority sequence of at least three clones of an HCV isolate or genotype.  
     
     
         59 . The method according to  claim 56  wherein the 3′-NTR comprises an extreme terminal sequence homologous to a DNA having the sequence  
       
         
           
                 
                 
               
                     
                 
                   5′-GGTGGCTCCATCTTAGCCCTAGTCACGGCTAG 
                   (SEQ ID NO:4). 
                 
                     
                 
                   CTGTGAAAGGTCCGTGAGCCGCATGACTGCAGAGA 
                 
                     
                 
                   GTGCTGATACTGGCCTCTCTGCTGATCATGT-3′ 
                 
                     
                 
             
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         60 . The method according to  claim 56  wherein the HCV nucleic acid has a positive strand sequence as depicted in or corresponding to SEQ ID NO:1 comprising substitution of a homologous region from another HCV isolate or genotype.  
     
     
         61 . An in vitro method for detecting antibodies to HCV in a biological sample from a subject comprising: 
 a) contacting a biological sample from a subject with HCV virus particles of  claim 41  under conditions that permit binding of HCV-specific antibodies in the sample to the HCV virus particles; and    b) detecting binding of antibodies in the sample to the HCV virus particles, wherein detecting binding of antibodies in the sample to the HCV virus particles is indicative of the presence of antibodies to HCV in the sample.    
     
     
         62 . An in vitro method for detecting antibodies to HCV in a biological sample from a subject comprising: 
 a) contacting a biological sample from a subject with HCV virus particles of  claim 42  under conditions that permit binding of HCV-specific antibodies in the sample to the HCV virus particles; and    b) detecting binding of antibodies in the sample to the HCV virus particles,    wherein detecting binding of antibodies in the sample to the HCV virus particles is indicative of the presence of antibodies to HCV in the sample.    
     
     
         63 . An in vitro method for detecting the presence of HCV in a biological sample from a subject comprising: 
 a) contacting a cell line permissive for productive HCV infection with a biological sample, wherein the cell line has been modified to contain a transgene that express a reporter gene product expressed under control of a trans-acting factor produced by HCV; and    b) detecting expression of the reporter gene product,    wherein detection of expression of the reporter gene product is indicative of the presence of HCV in the biological sample from the subject.    
     
     
         64 . An in vitro method for detecting the presence of HCV in a biological sample from a subject comprising: 
 a) contacting a cell line permissive for productive HCV infection with a biological sample, wherein the cell line has been modified to contain a defective virus transgene, which defective virus transgene will express a reporter gene product at high levels under control of a trans-acting factor produced by HCV; and    b) detecting expression of the reporter gene product,    wherein detection of expression of the reporter gene product is indicative of the presence of HCV in the biological sample from the subject.    
     
     
         65 . The method according to  claim 64 , wherein the defective viral transgene produces an engineered alphavirus, the trans-acting helper factor is alphavirus nsP4 polymerase, and wherein the alphavirus nsP4 polymerase is expressed as a chimeric fusion protein with HCV NS4A, such that the alphavirus nsP4 polymerase-HCV NS4A chimeric fusion protein is cleaved by HCV NS3 proteinase to release functional alphavirus nsP4 polymerase.  
     
     
         66 . The method according to  claim 63  or  64  wherein the biological sample is selected from the group consisting of blood, serum, plasma, blood cells, lymphocytes, and liver tissue biopsy.  
     
     
         67 . A test kit for HCV comprising authentic HCV virus components.  
     
     
         68 . A diagnostic test kit for HCV comprising components derived from an authentic HCV virus.

Cited by (0)

No later patents cite this yet.

References (0)

No backward citations on record.