US2003119104A1PendingUtilityA1

Chromosome-based platforms

Priority: May 30, 2001Filed: May 30, 2002Published: Jun 26, 2003
Est. expiryMay 30, 2021(expired)· nominal 20-yr term from priority
C12N 15/90C12Q 1/6897C12N 2800/108C12N 2830/85C07K 14/005C12N 9/22C12N 2800/30G01N 2500/10C12N 2795/10322C12N 2830/00C12N 15/85C12N 2800/208C12N 2830/60A61P 35/00C12N 15/63C12N 15/902C12N 2840/20C12N 2840/203C12N 2830/15C12N 2830/40
49
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Artificial chromosomes, including ACes, that have been engineered to contain available sites for site-specific, recombination-directed integration of DNA of interest are provided. These artificial chromosomes permit tractable, efficient, rational engineering of the chromosome for a variety of applications.

Claims

exact text as granted — not AI-modified
What is claimed is:  
     
         1 . A eukaryotic chromosome comprising one or a plurality of att site(s), wherein: 
 an att site is heterologous to the chromosome; and    an att site permits site-directed integration in the presence of lambda integrase.    
     
     
         2 . The eukaryotic chromosome of  claim 1 , wherein the att sites are selected from the group consisting of attP and attB or attL and attR, or variants thereof.  
     
     
         3 . The eukaryotic chromosome of  claim 1  that is an artificial chromosome.  
     
     
         4 . The eukaryotic chromosome of  claim 1  that is an artificial chromosome expression system (ACes).  
     
     
         5 . The eukaryotic chromosome of  claim 4  that is predominantly heterochromatin.  
     
     
         6 . The chromosome of  claim 1  that is an artificial chromosome that contains no more than about 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% euchromatin.  
     
     
         7 . The chromosome of  claim 1  that is a plant chromosome.  
     
     
         8 . The chromosome of  claim 1  that is an animal chromosome.  
     
     
         9 . The chromosome of  claim 7  that is a plant artificial chromosome.  
     
     
         10 . The chromosome of  claim 8  that is an animal artificial chromosome.  
     
     
         11 . The chromosome of  claim 8  that is a mammalian chromosome.  
     
     
         12 . The chromosome of  claim 11  that is a mammalian artificial chromosome.  
     
     
         13 . The chromosome of  claim 6  that is an artificial chromosome expression system (ACes).  
     
     
         14 . A platform artificial chromosome expression system (ACes) comprising one or a plurality of sites that participate in recombinase catalyzed recombination.  
     
     
         15 . The ACes of  claim 14  that contains one site.  
     
     
         16 . The ACes of  claim 14  that is predominantly heterochromatin.  
     
     
         17 . The ACes of  claim 14  that contains no more than about 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% euchromatin.  
     
     
         18 . The ACes of  claim 14  that is a plant ACes.  
     
     
         19 . The ACes of  claim 14  that is an animal ACes.  
     
     
         20 . The ACes of  claim 14  that is selected from a fish, insect, reptile, amphibian, arachnid or a mammalian ACes.  
     
     
         21 . The ACes of  claim 14  that is a fish ACes.  
     
     
         22 . The artificial chromosome expression system (ACes) of  claim 14 , wherein the recombinase and site(s) are from the Cre/lox system of bacteriophage P1, the int/att system of lambda phage, the FLP/FRT system of yeast, the Gin/gix recombinase system of phage Mu, the Cin recombinase system, the Pin recombinase system of  E. coli  and the R/RS system of the pSR1 plasmid, or any combination thereof.  
     
     
         23 . A method of introducing heterologous nucleic acid into a chromosome, comprising: 
 contacting a chromosome of  claim 1  with a nucleic acid molecule comprising both the heterologous nucleic acid and a recombination site, in the presence of a recombinase that promotes recombination between the sites in the chromosome and in the nucleic acid molecule.    
     
     
         24 . The method of  claim 23 , wherein the recombinase is selected from the group consisting of Cre, Gin, Cin, Pin, FLP, a phage integrase and R from the pSR1 plasmid.  
     
     
         25 . The method of  claim 23 , wherein the nucleic acid molecule encodes a therapeutic protein, antisense nucleic acid, or comprises an artificial chromosome.  
     
     
         26 . The method of  claim 25 , wherein the nucleic acid molecule comprises a yeast artificial chromosomes (YAC), a bacterial artificial chromosome (BAC) or an insect artificial chromosome (IAC).  
     
     
         27 . A combination, comprising, the chromosome of  claim 1  and a first vector comprising the cognate recombination site, wherein the cognate recombination site is a site that recombines with the site engineered into the chromosome.  
     
     
         28 . The combination of  claim 27 , further comprising nucleic acid encoding a recombinase, wherein the nucleic acid is on a second vector or on the first vector, or on the ACes under an inducible promoter.  
     
     
         29 . The combination of  claim 28 , wherein the recombinase and sites are from the Cre/lox system of bacteriophage P1, the int/att system of lambda phage, the FLP/FRT system of yeast, the Gin/gix recombinase system of phage Mu, the Pin recombinase system of  E. coli  and the R/RS system of the pSR1 plasmid, or any combination thereof.  
     
     
         30 . The combination of  claim 28 , wherein a vector is the plasmid pCXLamIntR.  
     
     
         31 . The combination of  claim 27 , wherein a vector is the plasmid pDsRedN1-attB.  
     
     
         32 . A kit, comprising the combination of  claim 27  and optionally instructions for introducing heterologous nucleic acid into the chromosome.  
     
     
         33 . A method for introducing heterologous nucleic acid into a platform artificial chromosome, comprising: 
 (a) mixing an artificial chromosome comprising at least a first recombination site and a vector comprising at least a second recombination site and the heterologous nucleic acid;    (b) incubating the resulting mixture in the presence of at least one recombination protein under conditions whereby recombination between the first and second recombination sites is effected, thereby introducing the heterologous nucleic acid into the artificial chromosome.    
     
     
         34 . The method of  claim 33 , wherein the artificial chromosome is an ACes.  
     
     
         35 . The method of  claim 33 , wherein said mixing step (a) is conducted in cells ex vivo.  
     
     
         36 . The method of  claim 33 , wherein said mixing step (a) is conducted extracellularly in an in vitro reaction mixture.  
     
     
         37 . The method of  claim 33 , wherein the at least one recombination protein is encoded by a bacteriophage selected from the group consisting of bacteriophage lambda, phi 80, P22, P2, 186, P4 and P1.  
     
     
         38 . The method of  claim 37 , wherein the at least one recombination protein is encoded by bacteriophage lambda, or mutants thereof.  
     
     
         39 . The method of  claim 33 , wherein at least one recombination protein is selected from the group consisting of Int, IHF, Xis and Cre, γδ, Tn3 resolvase, Hin, Gin, Cin and Flp.  
     
     
         40 . The method of  claim 32 , wherein the recombination sites are selected from the group consisting of att and lox P sites.  
     
     
         41 . The method of  claim 33 , wherein the first and/or second recombination site contains at least one mutation that removes one or more stop codons.  
     
     
         42 . The method of  claim 33 , wherein the first and/or second recombination site contains at least one mutation that avoids hairpin formation.  
     
     
         43 . The method of  claim 33 , wherein the first and/or second recombination site comprises at least a first nucleic acid sequence selected from the group consisting of SEQ ID NOs:41-56:  
       
         
           
                 
                 
                 
                 
               
                     
                     
                 
                     
                   a) RKYCWGCTTTYKTRTACNAASTSGB; 
                   (SEQ ID NO:41) 
                     
                 
                     
                   (m-att) 
                 
                     
                     
                 
                     
                   b) AGCCWGCTTTYKTRTACNAACTSGB; 
                   (SEQ ID NO:42) 
                 
                     
                   (m-attB) 
                 
                     
                     
                 
                     
                   c) GTTCAGCTTTCKTRTACNAACTSGB; 
                   (SEQ ID NO:43) 
                 
                     
                   (m-attR) 
                 
                     
                     
                 
                     
                   d) AGCCWGCTTTCKTRTACNAAGTSGB; 
                   (SEQ ID NO:44) 
                 
                     
                   (m-attL) 
                 
                     
                     
                 
                     
                   e) GTTCAGCTTTYKTRTACNAAGTSGB; 
                   (SEQ ID NO:45) 
                 
                     
                   (m-attP1) 
                 
                     
                     
                 
                     
                   f) AGCCTGCTTTTTTGTACAAACTTGT; 
                   (SEQ ID NO:46) 
                 
                     
                   (attB1) 
                 
                     
                     
                 
                     
                   g) AGCCTGCTTTCTTGTACAAACTTGT; 
                   (SEQ ID NO:47) 
                 
                     
                   (attB2) 
                 
                     
                     
                 
                     
                   h) ACCCAGGTTTCTTGTAGAAACTTGT; 
                   (SEQ ID NO:48) 
                 
                     
                   (attB3) 
                 
                     
                     
                 
                     
                   i) GTTCAGCTTTTTTGTACAAACTTGT; 
                   (SEQ ID NO:49) 
                 
                     
                   (attR1) 
                 
                     
                     
                 
                     
                   j) GTTCAGCTTTCTTGTACAAACTTGT; 
                   (SEQ ID NO:50) 
                 
                     
                   (attR2) 
                 
                     
                     
                 
                     
                   k) GTTCAGGTTTCTTGTACAAAGTTGG; 
                   (SEQ ID NO:51) 
                 
                     
                   (attR3) 
                 
                     
                     
                 
                     
                   l) AGCCTGCTTTTTTGTACAAAGTTGG; 
                   (SEQ ID NO:52) 
                 
                     
                   (attL1) 
                 
                     
                     
                 
                     
                   m) AGCCTGCTTTCTTGTACAAAGTTGG; 
                   (SEQ ID NO:53) 
                 
                     
                   (attL2) 
                 
                     
                     
                 
                     
                   n) ACCCAGCTTTCTTGTACAAAGTTGG; 
                   (SEQ ID NO:54) 
                 
                     
                   (attL3) 
                 
                     
                     
                 
                     
                   o) GTTCAGCTTTTTTGTACAAAGTTGG; 
                   (SEQ ID NO:55) 
                 
                     
                   (attP1) 
                 
                     
                     
                 
                     
                   p) GTTCAGCTTTCTTGTACAAAGTTGG; 
                   (SEQ ID NO:56) 
                 
                     
                   (attP2, P3) 
                 
                     
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
         and a corresponding or complementary DNA or RNA sequence, wherein R=A or G, K=G or T/U, Y=C or T/U, W=A or T/U, N=A or C or G or T/U, S=C or G, and B=C or G or T/U; and  
         the core region does not contain a stop codon in one or more reading frames.  
       
     
     
         44 . The method of  claim 33 , wherein the first and/or second recombination site comprises at least a first nucleic acid sequence selected from the group consisting of a mutated att recombination site containing at least one mutation that enhances recombinational specificity, a complementary DNA sequence thereto, and an RNA sequence corresponding thereto.  
     
     
         45 . The method of  claim 33 , wherein the vector comprising the second site further encodes at least one selectable marker.  
     
     
         46 . The method of  claim 45 , wherein the marker is a promoterless marker, which, upon recombination is under the control of a promoter and is thereby expressed.  
     
     
         47 . The method of  claim 46 , wherein the first recombination site is attP and is in the sense orientation prior to recombination.  
     
     
         48 . The method of  claim 46 , wherein the selectable marker is selected from the group consisting of an antibiotic resistance gene, and a detectable protein, wherein the detectable protein is chromogenic, fluorescent, or capable of being bound by an antibody and FACs sorted.  
     
     
         49 . The method of  claim 48 , wherein the selectable marker is selected from the group consisting of green fluorescent protein (GFP), red fluorescent protein (RFP), blue fluorescent protein (BFP), and  E. coli  histidinol dehydrogenase (hisD).  
     
     
         50 . A cell comprising, the chromosome of  claim 1 .  
     
     
         51 . The cell of  claim 50 , wherein the cell is a nuclear donor cell.  
     
     
         52 . The cell of  claim 50 , wherein the cell is a stem cell.  
     
     
         53 . The stem cell of  claim 52 , wherein said stem cell is human and is selected from the group consisting of a mesenchymal stem cell, a hematopoietic stem cell, an adult stem cell and an embryonic stem cell.  
     
     
         54 . The cell of  claim 50 , wherein the cell is mammalian.  
     
     
         55 . The cell of  claim 54 , wherein the mammal is selected from the group consisting of humans, primates, cattle, pigs, rabbits, goats, sheep, mice, rats, guinea pigs, hamsters, cats, dogs, and horses.  
     
     
         56 . The cell of  claim 50 , wherein the cell is a plant cell.  
     
     
         57 . A cell comprising the platform ACes of  claim 14 .  
     
     
         58 . The cell of  claim 57 , wherein the cell is a nuclear donor cell.  
     
     
         59 . The cell of  claim 57 , wherein the cell is a stem cell.  
     
     
         60 . The stem cell of  claim 59 , wherein said stem cell is human and is selected from the group consisting of a mesenchymal stem cell, a hematopoietic stem cell, an adult stem cell and an embryonic stem cell.  
     
     
         61 . A human mesenchymal cell comprising an artificial chromosome.  
     
     
         62 . The human mesenchymal cell of  claim 61 , wherein said artificial chromosome is an ACes.  
     
     
         63 . The human mesenchymal cell of  claim 62 , wherein the ACes is a platform-ACes.  
     
     
         64 . A method for introducing heterologous nucleic acid into the mesenchymal cell of  claim 63 , comprising: 
 (a) introducing into the cell of  claim 63 , wherein the platform-ACes has a first recombination site, a vector comprising at least a second recombination site and the heterologous nucleic acid;    (b) incubating the resulting mixture in the presence of at least one recombination protein under conditions whereby recombination between the first and second recombination sites is effected, thereby introducing the heterologous nucleic acid into the platform-ACes within the mesenchymal cell.    
     
     
         65 . A lambda-intR mutein comprising a glutamic acid to arginine change at position 174 of wild-type lambda-intR.  
     
     
         66 . The lambda-intR mutein of  claim 65 , wherein the lambda-intR mutein comprises SEQ ID NO:37.  
     
     
         67 . The method of  claim 46  wherein the promoterless marker is transcriptionally downstream of the heterologous nucleic acid, wherein the heterologous nucleic acid encodes a heterologous protein, and wherein the expression level of the selectable marker is transcriptionally linked to the expression level of the heterologous protein.  
     
     
         68 . The method of  claim 67 , wherein the selectable marker and the heterologous nucleic acid are transcriptionally linked by the presence of a IRES between them.  
     
     
         69 . The method of  claim 68 , wherein the selectable marker is selected from the group consisting of an antibiotic resistance gene, and a detectable protein, wherein the detectable protein is chromogenic or fluorescent.  
     
     
         70 . The method of  claim 69 , wherein the selectable marker is selected from the group consisting of green fluorescent protein (GFP), red fluorescent protein (RFP), blue fluorescent protein (BFP), and  E. coli  histidinol dehydrogenase.  
     
     
         71 . The method of  claim 67  further comprising expressing the heterologous protein and isolating the heterologous protein.  
     
     
         72 . A method for producing a transgenic animal, comprising introducing a platform-ACes into an embryonic cell.  
     
     
         73 . The method of  claim 72 , wherein the embryonic cell is a stem cell.  
     
     
         74 . The method of  claim 72 , wherein the embryonic cell is in an embryo.  
     
     
         75 . The method of  claim 72 , wherein the platform-ACes comprises heterologous nucleic acid that encodes a therapeutic product.  
     
     
         76 . The method of  claim 72 , wherein the transgenic animal is a fish, insect, reptile, amphibians, arachnid or mammal.  
     
     
         77 . The method of  claim 72 , wherein the ACes is introduced by cell fusion, lipid-mediated transfection by a carrier system, microinjection, microcell fusion, electroporation, microprojectile bombardment or direct DNA transfer.  
     
     
         78 . A transgenic animal produced by the method of  claim 72 .  
     
     
         79 . A cell line useful for making a library of ACes, comprising a multiplicity of heterologous recombination sites randomly integrated throughout the endogenous chromosomes.  
     
     
         80 . A method of making a library of ACes comprising random portions of a genome, comprising introducing one or more ACes into the cell line of  claim 79 , under conditions that promote the site-specific chromosomal arm exchange of the ACes into, and out of, a multiplicity of the heterologous recombination sites within the cell's chromosomal DNA; and isolating said multiplicity of ACes, thereby producing a library of ACes whereby multiple ACes have different portions of the genome within.  
     
     
         81 . A library of cells useful for genomic screening, said library comprising a multiplicity of cells, wherein each cell comprises an ACes having a mutually exclusive portion of a chromosomal nucleic acid therein.  
     
     
         82 . The library of cells of  claim 81 , wherein the cells of the library are from a different species than the chromosomal nucleic acid within the ACes.  
     
     
         83 . A method of making one or more cell lines, comprising 
 a) integrating into endogenous chromosomal DNA of a selected cell species, a multiplicity of heterologous recombination sites,    b) introducing a multiplicity of ACes under conditions that promote the site-specific chromosomal arm exchange of the ACes into, and out of, a multiplicity of the heterologous recombination sites integrated within the cell's endogenous chromosomal DNA;    c) isolating said multiplicity of ACes, thereby producing a library of ACes whereby a multiplicity of ACes have mutually exclusive portions of the endogenous chromosomal DNA therein;    d) introducing the isolated multiplicity of ACes of step c) into a multiplicity of cells, thereby creating a library of cells;    e) selecting different cells having mutually exclusive ACes therein and clonally expanding or differentiating said different cells into clonal cell cultures, thereby creating one or more cell lines.    
     
     
         84 . The method of  claim 23 , wherein the nucleic acid molecule with a recombination site is a PCR product.  
     
     
         85 . Method of  claim 23  wherein the recombinase is a protein and the recombination event occurs in vitro.  
     
     
         86 . The method of  claim 33 , wherein the vector is a PCR product comprising a second recombination site.  
     
     
         87 . The lambda-intR mutein of  claim 65 , wherein the mutein further comprises an amino acid signal for nuclear localization.  
     
     
         88 . The lambda-intR mutein of  claim 65 , wherein the mutein further comprises an epitope tag for protein purification.  
     
     
         89 . A modified iron-induced promoter comprising SEQ ID NO: 128.  
     
     
         90 . A plasmid or expression cassette comprising the promoter of  claim 89 .  
     
     
         91 . A vector, comprising: 
 a recognition site for recombination; and    a sequence of nucleotides that targets the vector to an amplifiable region of a chromosome.    
     
     
         92 . The vector of  claim 91 , wherein the amplifiable region comprises heterochromatic nucleic acid.  
     
     
         93 . The vector of  claim 91 , wherein the amplifiable region comprises rDNA.  
     
     
         94 . The vector of  claim 93 , wherein the rDNA comprises an intergenic spacer.  
     
     
         95 . The vector of  claim 91 , further comprising nucleic acid encoding a selectable marker that is not operably associated with any promoter.  
     
     
         96 . The vector of  claim 91 , wherein the chromosome is a mammalian chromosome.  
     
     
         97 . The vector of  claim 91 , wherein the chromosome is a plant chromosome.  
     
     
         98 . A cell of  claim 57  that is a plant cell, wherein the ACes platform is a MAC.  
     
     
         99 . The plant cell of  claim 98 , wherein the MAC comprises transcriptional regulatory sequence of nucleotides derived from plants.  
     
     
         100 . The plant cell of  claim 99 , wherein the regulatory sequence is selected from the group consisting of promoters, terminators, enhancers, silencers and transcription factor binding sites.  
     
     
         101 . A cell of  claim 57  that is an animal cell, wherein the ACes platform is a plant artificial chromosome (PAC).  
     
     
         102 . The cell of  claim 101  that is a mammalian cell.  
     
     
         103 . The cell of  claim 98 , wherein the MAC comprises transcriptional regulatory sequence of nucleotides derived from plants.  
     
     
         104 . The cell of  claim 102 , wherein the MAC comprises transcriptional regulatory sequence of nucleotides derived from plants.  
     
     
         105 . The cell of  claim 104 , wherein the regulatory sequence is selected from the group consisting of promoters, terminators, enhancers, silencers and transcription factor binding sites.  
     
     
         106 . A method, comprising: 
 introducing a vector of  claim 91  into a cell;    growing the cells; and    selecting a cell comprising an artificial chromosome that comprises one or more repeat regions.    
     
     
         107 . The method of  claim 106 , wherein sufficient portion of the vector integrates into a chromosome in the cell to result in amplification of chromosomal DNA.  
     
     
         108 . The method of  claim 106 , wherein the artificial chromsome is an ACes.  
     
     
         109 . A method for screening, comprising: 
 contacting a cell comprising a reporter ACes with test compounds or known compounds, wherein:    the reporter ACes comprises one or a plurality of reporter constructs;    a reporter construct comprises a reporter gene in operative linkage with a regulatory region responsive to test or known compounds; and    detecting any increase or decrease in signal output from the reporter, wherein a change in the signal is indicative of activity of the test or known compound on the regulatory region.    
     
     
         110 . The method of  claim 109 , wherein the reporter is operatively linked to a promoter that controls expression of a gene in a signal transduction pathway, whereby activation or reduction in the signal indicates that the pathway is activated or down-regulated by the test compound.  
     
     
         111 . The method of  claim 109 , wherein the reporter in the construct encodes drug resistance or encodes a fluorescent protein.  
     
     
         112 . The method of  claim 111 , wherein the fluorescent protein is selected from the group consisting of red, green and blue fluorescent proteins.  
     
     
         113 . The method of  claim 109 , wherein the ACes comprises a plurality of reporter-linked constructs, each with a different reporter, whereby the pathway(s) affected by the test compounds can be elucidated.  
     
     
         114 . The method of  claim 109 , wherein a reporter is operatively linked to a promoter that is transcriptionally regulated in resopnse to DNA damage, and the test compounds are genotoxicants.  
     
     
         115 . The method of  claim 114 , wherein the DNA damage is induced by apoptosis, necrosis or cell-cycle perturbations.  
     
     
         116 . The method of  claim 114 , wherein unknown compounds are screened to assess whether they are genotoxicants.  
     
     
         117 . The method of  claim 114 , wherein the promoter is a cytochrome P450-profiled promoter.  
     
     
         118 . The method of  claim 114 , wherein the cell is in a transgenic animal and toxicity is assessed in the animal.  
     
     
         119 . The method of  claim 109 , wherein: 
 the cell is a patient cell sample; the patient has a disease;    the regulatory region is one targeted by a drug or drug regimen; and    the method assesses the effectiveness of a treatment for the disease for the particular patient.    
     
     
         120 . The method of  claim 119 , wherein the cell is a tumor cell.  
     
     
         121 . The method of  claim 109 , wherein the cell is a stem cell or a progenitor cell, whereby expression of the reporter is operatively linked to a regulatory region exprssed in the cells to thereby identify stem cells or progenitor cell.  
     
     
         122 . The method of  claim 109 , wherein the cell is in an animal; and the method comprises whole-body imaging to monitor expression of the reporter in the animal.  
     
     
         123 . A reporter ACes comprises one or a plurality of reporter constructs, wherein the reporter construct comprises a reporter gene in operative linkage with a regulatory region responsive to test or known compounds.

Join the waitlist — get patent alerts

Track US2003119104A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.