Human complement C3-binding protein from streptococcus pneumoniae

Abstract

The present invention relates to the identification and use of a family of human complement C3-degrading proteinases expressed by S. pneumoniae . The proteinase has a molecular weight of about 24 kD to about 34 kD as determined on a 10% SDS polyacrylamide gel. A preferred proteinase of this invention includes the amino acid sequence of SEQ ID NO: 2.

What is claimed is:  
     
         1 . An isolated protein compising at least an 80% sequence identity of SEQ ID NO: 2 and capable of degrading human complement protein C3.  
     
     
         2 . The protein of  claim 1  wherein the protein is isolated from  S. pneumoniae.    
     
     
         3 . The protein of  claim 1  wherein the protein binds human complement protein C3.  
     
     
         4 . The protein of  claim 1 , wherein the protein is a recombinant protein.  
     
     
         5 . The protein of  claim 1  wherein the protein is an isolated protein  
     
     
         6 . The protein of  claim 1  having a molecular weight as determined on a 10% polyacrylamide gel of between about 24 kDa to about 34 kDa  
     
     
         7 . A peptide comprising at least 15 sequential amino acids from the protein of  claim 1 .  
     
     
         8 . An isolated protein comprising SEQ ID NO: 2.  
     
     
         9 . A peptide comprising at least 15 sequential amino acids from SEQ ID NO: 2.  
     
     
         10 . A protein comprising SEQ ID NO: 2, wherein the protein has a molecular weight as determined on a 10% polyacrylamide gel of between about 24 kDa to about 34 kDa  
     
     
         11 . The protein of  claim 10  wherein the protein is isolatable from  S. pneumoniae.    
     
     
         12 . The protein of  claim 10  wherein the protein is a recombinant protein.  
     
     
         13 . The protein of  claim 10  wherein the protein degrades human complement rotein C3.  
     
     
         14 . A protein comprising amino acids 1-50 of SEQ ID NO: 2.  
     
     
         15 . A nucleic acid fragment comprising nucleic acids 1246 to 1863 of FIG. 1A.  
     
     
         16 . A protein that degrdes human complement protein C3 and wherein nucleic acid encoding the protein hybridizes to SEQ ID NO: 1 under hybridization conditions of 6×SSC, 5×Denhardt, 0.5% SDS, and 100 μg/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65° C. and washed in 2×SSC, 0.1% SDS one time at room tempe for about 10 minutes followed by one time at, 65° C. for about 15 minutes followed by at least one wash in 0.2×SSC; 0.1% SDS at room temperature for at least 3-5 minutes.  
     
     
         17 . An immune-system stimulating composition comprising an effective amount of an immune system-stimulating peptide or polypeptide comprising at least 15 amino acids from a protein comprising at least an 80% sequence identity with SEQ ID NO: 2 and capable of degding human complement protein C3.  
     
     
         18 . The composition of  claim 17  wherein the protein is isolatable from  S. pneumoniae.    
     
     
         19 . The immune system stimulating composition of  claim 15  further comprising at least one other immune stimulating peptide, polypeptide or protein from  S. pneumoniae.    
     
     
         20 . An antibody capable of spificaUy binding to a protein comprising at least a 90% sequence identity with SEQ ID NO: 2 and capable of degrading human complement protein C3.  
     
     
         21 . The antibody  claim 20  wherein the antibody is a monoclonal antibody.  
     
     
         22 . The antibody of  claim 20  wherein the antibody is an antibody fragment  
     
     
         23 . The antibody of  claim 20 , wherein the antibody is a polyclonal antibody.  
     
     
         24 . The antibody of  claim 20 , wherein the antibody is obtained from a mouse, a rat, human, or a rabbit  
     
     
         25 . A nucleic acid fragment capable of hybridizing to SEQ ID NO: 1 under hybridization conditions of 6×SSC, 5×Denhardt, 0.5% SDS, and 100 μg/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65° C. and washed in 2×SSC, 0.1% SDS one time at room temperature for about 10 minutes followed by one time at, 65° C. for about 15 minutes followed by at least one wash in 0.2×SSC, 0.1% SDS at room temperature for at least 3-5 minutes.  
     
     
         26 . The nucleic acid of  claim 25  isolated from an  S. pneumoniae  genome.  
     
     
         27 . The nucleic acid of  claim 25  wherein the nucleic acid fragment encodes at least a portion of a protein.  
     
     
         28 . The nucleic acid of  claim 27  wherein the protein degrades human complement C3.  
     
     
         29 . The nucleic acid fragment of  claim 27  wherein the nucleic acid fragment encodes a protein that does not degrade human complement C3.  
     
     
         30 . The nucleic acid of  claim 25  in a nucleic acid vector.  
     
     
         31 . The nucleic acid of  claim 30  wherein the vector is an expression vector capable of producing at least a portion of a protein.  
     
     
         32 . A cell comprising the nucleic acid of  claim 25 .  
     
     
         33 . The cell of  claim 32  wherein the cell is a bacterium or a eukaryotic cell.  
     
     
         34 . An isolated nucleic acid fragent comprising the nucleic acid sequence gctcccagtatgcgtactcgtaaggtagagggaagaaaaaaactagctag.  
     
     
         35 . A method for producing an immune response to  S. pneumoniae  in an animal comprising the steps of: 
 administering a composition comprising a therapeutically effective amount of at least a portion of a protein to a mammal, wherein nucleic acid encoding the protein hybridizes to SEQ ID NO: 1 under hybridization conditions of 6×SSC, 5×Denhardt, 0.5% SDS, and 100 μg/ml fragmented and denatured salmon sperm DNA, hybridized overnight at 65° C. and washed in 2×SSC, 0.1% SDS one time at room temperature for about 10 minutes followed by one time at 65° C. for about 15 minutes followed by at least one wads in 0.2×SSC, 0.1% SDS at room temperature for at least 3-5 minutes; and    obtaining an immune response to the protein.    
     
     
         36 . The method of  claim 35  wherein the immune response is a B cell response.  
     
     
         37 . The method of  claim 35  wherein the immune response is a T cell response.  
     
     
         38 . The method of  claim 35  wherein the at least a portion of a protein is at least 15 amino acids in length.  
     
     
         39 . The method of  claim 35  wherein the composition filrter comprises at least one other protein firom  S. pneumoniae.    
     
     
         40 . The method of  claim 35  wherein the protein comprises at least 15 amino acids of SEQ ID NO: 2.  
     
     
         41 . A bacteria comprising an insertional mutation, wherein the insertion mutation is in a gene encoding a protein capable of degrading human complement C3.  
     
     
         42 . The bactera of  claim 41  wherein the bacteria comprises an insertional duplication mutation.  
     
     
         43 . An isolated protein of about 24 kDa to about 34 kDa from  Streptococcus pneumoniae  that is capable of binding to and degrading human complement C3.  
     
     
         44 . A method for inhibiting  Streptococcus pneumoniae -mediated C3 degradation comprising the step of: 
 contacting a  Streptococcus pneumonia  bacterium with antibody capable of binding to a protein with the amino acid sequence of SEQ ID NO: 2.    
     
     
         45 . An isolated nucleic acid fragment comprising the nucleic acid sequence of SEQ ID NO: 1  
     
     
         46 . An RNA fragment transcribed by a double-stranded DNA sequence comprising SEQ ID NO: 1.  
     
     
         47 . The antibody of  claim 20  wherein the antibody inhibits the binding of  Streptococcus pneumoniae  bacterium to human complement C3 protein.  
     
     
         48 . The antibody of  claim 20  wherein the protein is isolated and purified from  S. pneumoniae.    
     
     
         49 . The antibody of  claim 20 , wherein the protein is a recombinant protein.  
     
     
         50 . The antibody of  claim 20 , wherein the protein has a molecular weight as determined on a 10% polyacrylamide gel of between about 24 kDa to about 34 kDa.  
     
     
         51 . An antibody that specifically binds to a peptide comprising at least 15 sequential amino acids from a protein, wherein the protein comprises at least an 80% sequence identity with SEQ ID NO: 2 and wherein the protein binds human complement protein C3.  
     
     
         52 . An antibody that specifically binds to a protein comprising SEQ ID NO: 2.  
     
     
         53 . An antibody that specifically binds to a peptide comprising at least 15 sequential amino acids from SEQ ID NO: 2, wherein said peptide binds human complement C3.  
     
     
         54 . The antibody of  claim 20 , wherein the protein degrades human complement protein C3.  
     
     
         55 . An antibody that specifically binds to a peptide consisting of at least 15 sequential amino acids from SEQ ID NO: 2, wherein the antibody inhibits the binding of  Streptococcus pneumoniae  bacterium to human complement C3 protein.  
     
     
         56 . An antibody that specifically binds to a protein comprising amino acids 1-50 of SEQ ID NO: 2.  
     
     
         57 . An antibody that specifically binds to a protein, wherein the protein binds human complement protein C3 and wherein nucleic acid encoding the protein hybridizes to SEQ ID NO: 1 under hybridization conditions of 6×SSC, 5×Denhardt, 0.5% SDS, and 100 μg/ml fragmented and denatured salmon sperm DNA hybridized overnight at 65° C. and washed in 2×SSC, 0.1% SDS one time at room temperature for about 10 minutes followed by one time at, 65° C. for about 15 minutes followed by at least one wash in 0.2×SSC, 0.1% SDS at room temperature for at least 3-5 minutes.  
     
     
         58 . An antibody that specifically binds to a protein of about 34 kDa from  Streptococcus pneumoniae , wherein the protein binds to human complement C3.  
     
     
         59 . The antibody fragment of  claim 22  wherein the antibody fragment comprises at least one variable domain.  
     
     
         60 . The antibody of  claim 59 , wherein the variable domain is obtained from a mouse, a rat, a human, or a rabbit.  
     
     
         61 . A chimeric protein comprising at least one antibody variable domain, wherein the antibody variable domain specifically binds to a protein comprising at least a 80% sequence identity with SEQ ID NO: 2 and wherein the protein binds human complement protein C3.  
     
     
         62 . The chimeric protein of  claim 61 , wherein the antibody variable domain is obtained from a mouse, a rat, a human, or a rabbit.  
     
     
         63 . A composition comprising an antibody that specifically binds to a protein comprising at least a 80% sequence identity with SEQ ID NO: 2 and wherein the protein binds human complement protein C3.  
     
     
         64 . The composition of  claim 63  further comprising a pharmaceutically acceptable carrier.  
     
     
         65 . A composition comprising an antibody that specifically binds to a protein comprising at least a 80% sequence identity with SEQ ID NO: 2, wherein the protein binds human complement protein C3, wherein the antibody inhibits the binding of  Streptococcus pneumoniae  bacterium to human complement C3 protein.  
     
     
         66 . A composition comprising at least one antibody variable domain, wherein the antibody variable domain specifically binds to a protein comprising at least a 80% sequence identity with SEQ ID NO: 2 and wherein the protein binds human complement protein C3.  
     
     
         67 . The composition of  claim 66 , wherein the variable domain is obtained from a mouse, a rat, a human, or a rabbit.  
     
     
         68 . A method for inhibiting  Streptococcus pneumoniae -mediated C3 binding, the method comprising contacting  S. pneumoniae  bacteria with an antibody that specifically binds to a protein comprising at least a 80% sequence identity with SEQ ID NO: 2 and wherein the protein binds human compiemtent protein C3.  
     
     
         69 . The method of  claim 68 , wherein the contacting  S. pneumoniae  bacteria with an antibody is by administering the antibody to an animal.  
     
     
         70 . The method of  claim 69  wherein the animal suffers from a  S. pneumonia  bacterial infection.  
     
     
         71 . The method of  claim 70  wherein the infection is a localized or systemic bacterial infection.  
     
     
         72 . The method of  claim 70  wherein the infection is selected from the group consisting of bacterial pneumonia, bacterial meningitis, and an ear infection.  
     
     
         73 . The method of  claim 69  wherein the administering of the antibody prevents  S. pneumonia  bacterial colonization.  
     
     
         74 . A method of augmenting  S. pneumonia  opsonization, the method comprising administering to an animal an antibody that specifically binds to a protein comprising at least a 80% sequence identity with SEQ ID NO: 2, wherein the protein binds human complement protein C3, wherein the antibody inhibits the binding of  Streptococcus pneumoniae  bacterium to human complement C3 protein.