Immunostimulatory nucleic acid molecules

Abstract

Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.

1 . A method for treating an atopic condition, comprising 
 administering to a subject in need of treatment of an atopic condition an immunostimulatory nucleic acid, comprising:    5′ X 1 CGX 2  3′   wherein the immunostimulatory nucleic acid includes at least 8 nucleotides and wherein c is unmethylated and wherein X 1  and X 2  are nucleotides, in an effective amount to treat the atopic condition.    
     
     
         2 . The method of  claim 1 , wherein the atopic condition is atopic dermatitis.  
     
     
         3 . The method of  claim 1 , wherein X 1  is selected from the group consisting of A, G, and T, and wherein X 2  is selected from the group consisting of C and T.  
     
     
         4 . The method of  claim 1 , further comprising administering to the subject an allergen in conjunction with the administering of the immunostimulatory nucleic acid.  
     
     
         5 . The method of  claim 1 , wherein the immunostimulatory nucleic acid comprises  
       5′ X 1 X 2 CGX 3 X 4  3′ 
       wherein C is unmethylated and wherein X 1 , X 2 , X 3 , and X 4  are nucleotides.  
     
     
         6 . The method of  claim 5 , wherein X 1 X 2  is selected from the group consisting of GpT, GpG, GpA and ApA.  
     
     
         7 . The method of  claim 5 , wherein X 3 X 4  is selected from the group consisting of TpT and CpT.  
     
     
         8 . The method of  claim 5 , wherein X 1 X 2  is selected from the group consisting of GpT, GpG, GpA and ApA and wherein X 3 X 4  is selected from the group consisting of TpT and CpT.  
     
     
         9 . The method of  claim 5 , wherein 5′ X 1 X 2 CGX 3 X 4  3′ is not a palindrome.  
     
     
         10 . The method of  claim 5 , wherein the immunostimulatory nucleic acid comprises a sequence selected from the group consisting of  
       
         
           
                 
                 
                 
                 
               
                     
                     
                 
                     
                   TCCATGTCGGTCCTGATGCT, 
                   (SEQ ID NO: 37) 
                     
                 
                     
                     
                 
                     
                   TCCATGCCGGTCCTGATGCT, 
                   (SEQ ID NO: 38) 
                 
                     
                     
                 
                     
                   TCCATGGCGGTCCTGATGCT, 
                   (SEQ ID NO: 39) 
                 
                     
                     
                 
                     
                   TCCATGACGGTCCTGATGCT, 
                   (SEQ ID NO: 40) 
                 
                     
                     
                 
                     
                   TCCATGTCGCTCCTGATGCT, 
                   (SEQ ID NO: 42) 
                 
                     
                     
                 
                     
                   TCCATGTCGTTCCTGATGCT, 
                   (SEQ ID NO: 43) 
                 
                     
                     
                 
                     
                   TCCATGACGTTCCTGATGCT, 
                   (SEQ ID NO: 44) 
                 
                     
                     
                 
                     
                   and 
                 
                     
                     
                 
                     
                   TCCATAACGTTCCTGATGCT. 
                   (SEQ ID NO: 45) 
                 
                     
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         11 . The method of  claim 1 , wherein the immunostimulatory nucleic acid is a synthetic nucleic acid molecule.  
     
     
         12 . The method of  claim 1 , wherein the immunostimulatory nucleic acid is 8 to 100 nucleotides in length.  
     
     
         13 . The method of  claim 1 , wherein the immunostimulatory nucleic acid is 8 to 40 nucleotides in length.  
     
     
         14 . The method of  claim 1 , wherein the immunostimulatory nucleic acid is a stabilized nucleic acid molecule.  
     
     
         15 . The method of  claim 14 , wherein the immunostimulatory nucleic acid includes a phosphate backbone modification which is a phosphorothioate or phosphorodithioate modification.  
     
     
         16 . The method of  claim 1 , wherein the immunostimulatory nucleic acid is administered to the subject orally.  
     
     
         17 . The method of  claim 1 , wherein the immunostimulatory nucleic acid is administered to the subject transdermally.  
     
     
         18 . The method of  claim 1 , wherein the immunostimulatory nucleic acid is administered to the subject by injection.