US2004157220A1PendingUtilityA1

Methods and apparatus for sample tracking

41
Priority: Feb 10, 2003Filed: Feb 10, 2003Published: Aug 12, 2004
Est. expiryFeb 10, 2023(expired)· nominal 20-yr term from priority
Y02A50/30C12Q 1/6876C12Q 2600/158
41
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

A method and apparatus are provided for identifying a biological sample obtained during either paternity screening, genetic screening, prenatal diagnosis, presymptomatic diagnosis, diagnosis to detect the presence of a target microorganism carrier detection analysis, forensic chemical analysis, or diagnosis of a subject to determine whether a subject is afflicted with a particular disease or disorder, or is at risk of developing a particular disorder, wherein the result obtained from the analysis is associated with the unique DNA fingerprint biological barcode of the genotype of the subject being analyzed. The methods and apparatus of the invention have application in the fields of diagnostic medicine, disease diagnosis in animals and plants, identification of genetically inherited diseases in humans, family relationship analysis, forensic analysis, and microbial typing.

Claims

exact text as granted — not AI-modified
We claim:  
     
         1 . A method for identifying a biological sample comprising biological material of a mammal, which comprises the steps of: 
 a) obtaining amplification data indicative of amplification of at least two DNA markers of genomic DNA of the mammal;    b) generating indicia indicative of the amplification data; and    c) associating the indicia with the biological sample, whereby the indicia may be used to identify the biological sample.    
     
     
         2 . The method of  claim 1 , comprising obtaining amplification data indicative of amplification of at least three DNA markers of genomic DNA of the mammal.  
     
     
         3 . The method of  claim 2 , comprising obtaining amplification data indicative of amplification of at least five DNA markers of genomic DNA of the mammal.  
     
     
         4 . The method of  claim 1 , where said DNA markers are amplification primers selected from the group consisting of the following primer pairs:  
       
         
           
                 
                 
                 
                 
               
                     
                 
                   D3S1358 
                   5′ Primer ACTGCAGTCCAATCTGGGT 
                   (SEQ ID NO:1) 
                     
                 
                     
                 
                     
                   3′ primer ATGAAATCAACAGAGGCTTG; 
                   (SEQ ID NO:2) 
                 
                     
                 
                   D5S818 
                   5′ Primer GGGTGATTTTCCTCTTTGGT 
                   (SEQ ID NO:3) 
                 
                     
                 
                     
                   3′ primer TGATTCCAATCATAGCCACA; 
                   (SEQ ID NO:4) 
                 
                     
                 
                   D7S820 
                   5′ Primer TGTCATAGTTTAGAACGAACTAACG 
                   (SEQ ID NO:5) 
                 
                     
                 
                     
                   3′ primer CTGAGGTATCAAAAACTCAGAGG; 
                   (SEQ ID NO:6) 
                 
                     
                 
                   D13S317 
                   5′ Primer ACAGAAGTCTGGGATGTGGA 
                   (SEQ ID NO:7) 
                 
                     
                 
                     
                   3′ primer GCCCAAAAAGACAGACAGAA; 
                   (SEQ ID NO:8) 
                 
                     
                 
                   D16S539 
                   5′ Primer GATCCCAAGCTCTTCCTCTT 
                   (SEQ ID NO:9) 
                 
                     
                 
                     
                   3′ primer ACGTTTGTGTGTGCATCTGT; 
                   (SEQ ID NO:10) 
                 
                     
                 
                     
                   and complementary sequences thereto. 
                 
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         5 . The method of  claim 1 , further comprising: 
 diagnosing the DNA sample to obtain a result indicative of whether the mammal is afflicted with a particular disease or disorder, or is at risk of developing a particular disease or disorder; and    associating the result obtained from said diagnosis step with at least one of the amplification data or indicia.    
     
     
         6 . The method of  claim 5 , wherein associating the result obtained from said diagnosis step with the amplification data comprises saving the amplification data to a computer readable medium.  
     
     
         7 . The method of  claim 1 , further comprising: 
 obtaining data indicative of the presence of a pathogen in the biological sample; and    associating the data indicative of the presence of the pathogen with at least one of the amplification data or indicia, whereby the amplification data or indicia are indicative of the presence of the pathogen.    
     
     
         8 . The method of  claim 7 , wherein the data indicative of the presence of the pathogen are indicative of the type of pathogen.  
     
     
         9 . The method of  claim 1 , wherein generating the indicia further comprises printing a label comprising the indicia.  
     
     
         10 . The method of  claim 9 , comprising securing the label to a container comprising at least a portion of the sample.  
     
     
         11 . The method of  claim 1 , wherein the indicia are readable using an automated reader.  
     
     
         12 . A method for creating a database, the database comprising a plurality of locations, the method comprising: 
 for each of a plurality of mammals:    a) obtaining amplification data indicative of amplification of at least two DNA markers of genomic DNA of the mammal;    b) entering the amplification data in a first location of the database; and    c) entering first indicia in a second location of the database, the first indicia indicative of an identity of the mammal, wherein the first and second locations are related, whereby the database may be searched using one of the amplification data or first indicia to determine the other of the amplification data or first indicia.    
     
     
         13 . The method of  claim 12 , further comprising; 
 d) generating second indicia indicative of at least the amplification data; and    e) associating the second indicia with a biological sample obtained from the mammal, wherein the second indicia and the database may be used to determine the identity of the mammal from which the biological sample was obtained.    
     
     
         14 . The method of  claim 12 , wherein the step of obtaining comprises obtaining amplification data indicative of amplification of at least three DNA markers of genomic DNA of the mammal.  
     
     
         15 . The method of  claim 14 , wherein the step of obtaining comprises obtaining amplification data indicative of amplification of at least five DNA markers of genomic DNA of the mammal.  
     
     
         16 . The method of  claim 12 , where said DNA markers are amplification primers selected from the group consisting of the following primer pairs:  
       
         
           
                 
                 
                 
                 
               
                     
                 
                   D3S1358 
                   5′ Primer ACTGCAGTCCAATCTGGGT 
                   (SEQ ID NO:1) 
                     
                 
                     
                 
                     
                   3′ primer ATGAAATCAACAGAGGCTTG; 
                   (SEQ ID NO:2) 
                 
                     
                 
                   D5S818 
                   5′ Primer GGGTGATTTTCCTCTTTGGT 
                   (SEQ ID NO:3) 
                 
                     
                 
                     
                   3′ primer TGATTCCAATCATAGCCACA; 
                   (SEQ ID NO:4) 
                 
                     
                 
                   D7S820 
                   5′ Primer TGTCATAGTTTAGAACGAACTAACG 
                   (SEQ ID NO:5) 
                 
                     
                 
                     
                   3′ primer CTGAGGTATCAAAAACTCAGAGG; 
                   (SEQ ID NO:6) 
                 
                     
                 
                   D13S317 
                   5′ Primer ACAGAAGTCTGGGATGTGGA 
                   (SEQ ID NO:7) 
                 
                     
                 
                     
                   3′ primer GCCCAAAAAGACAGACAGAA; 
                   (SEQ ID NO:8) 
                 
                     
                 
                   D16S539 
                   5′ Primer GATCCCAAGCTCTTCCTCTT 
                   (SEQ ID NO:9) 
                 
                     
                 
                     
                   3′ primer ACGTTTGTGTGTGCATCTGT; 
                   (SEQ ID NO:10) 
                 
                     
                 
                     
                   and complementary sequences thereto. 
                 
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         17 . The method of  claim 12 , further comprising for each mammal: 
 diagnosing a DNA sample obtained from the mammal to obtain a result indicative of whether the mammal is afflicted with a particular disease or disorder, or is at risk of developing a particular disease or disorder; and    entering the result in a third location of the database, wherein the database may be searched using one of the amplification data or first indicia to determine the result.    
     
     
         18 . A sample tracking system, comprising: 
 a) a device configured to at least: 
 obtain amplification data indicative of amplification of at least two DNA markers of genomic DNA of a mammal;  
   b) a processor configured to at least: 
 generate indicia indicative of the amplification data; and  
 associate the indicia with the biological sample, whereby the indicia may be used to identify the biological sample.  
   
     
     
         19 . The method of  claim 18 , wherein the device is configured to obtain amplification data indicative of amplification of at least three DNA markers of genomic DNA of the mammal.  
     
     
         20 . The method of  claim 18 , wherein the device is configured to obtain amplification data indicative of amplification of at least five DNA markers of genomic DNA of the mammal.  
     
     
         21 . The method of  claim 18 , where said DNA markers are amplification primers selected from the group consisting of the following primer pairs:  
       
         
           
                 
                 
                 
                 
               
                     
                 
                   D3S1358 
                   5′ Primer ACTGCAGTCCAATCTGGGT 
                   (SEQ ID NO:1) 
                     
                 
                     
                 
                     
                   3′ primer ATGAAATCAACAGAGGCTTG; 
                   (SEQ ID NO:2) 
                 
                     
                 
                   D5S818 
                   5′ Primer GGGTGATTTTCCTCTTTGGT 
                   (SEQ ID NO:3) 
                 
                     
                 
                     
                   3′ primer TGATTCCAATCATAGCCACA; 
                   (SEQ ID NO:4) 
                 
                     
                 
                   D7S820 
                   5′ Primer TGTCATAGTTTAGAACGAACTAACG 
                   (SEQ ID NO:5) 
                 
                     
                 
                     
                   3′ primer CTGAGGTATCAAAAACTCAGAGG; 
                   (SEQ ID NO:6) 
                 
                     
                 
                   D13S317 
                   5′ Primer ACAGAAGTCTGGGATGTGGA 
                   (SEQ ID NO:7) 
                 
                     
                 
                     
                   3′ primer GCCCAAAAAGACAGACAGAA; 
                   (SEQ ID NO:8) 
                 
                     
                 
                   D16S539 
                   5′ Primer GATCCCAAGCTCTTCCTCTT 
                   (SEQ ID NO:9) 
                 
                     
                 
                     
                   3′ primer ACGTTTGTGTGTGCATCTGT; 
                   (SEQ ID NO:10) 
                 
                     
                 
                     
                   and complementary sequences thereto. 
                 
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         22 . The device of  claim 18 , wherein the device is further configured to obtain data indicative of the presence of a pathogen.  
     
     
         23 . The device of  claim 18 , wherein the device is microfluidic device comprising at least one substrate defining a microfluidic network.  
     
     
         24 . The system of  claim 18 , wherein the system is configured to provide a label comprising the indicia.  
     
     
         25 . A method for identifying a biological sample of a mammal, which comprises the steps of: 
 a) obtaining a genomic DNA sample from said mammal;    b) amplifying the genomic DNA sample using at least two primers for amplification of at least two DNA markers; and    c) identifying the amplified DNA markers from step b), wherein the genomic DNA sample's unique combination of amplified markers represents the molecular barcode for identification of the biological sample.    
     
     
         26 . A method for identification of a biological sample of a mammal, which comprises the steps of: 
 a) obtaining a genomic DNA sample from said mammal;    b) performing DNA amplification of the genomic DNA sample using at least two primers for amplification of at least two DNA markers, wherein said DNA marker amplification primers are selected from the group consisting of the following primer pairs:                                  D3S1358   5′ Primer ACTGCAGTCCAATCTGGGT   (SEQ ID NO:1)                   3′ primer ATGAAATCAACAGAGGCTTG;   (SEQ ID NO:2)           D5S818   5′ Primer GGGTGATTTTCCTCTTTGGT   (SEQ ID NO:3)               3′ primer TGATTCCAATCATAGCCACA;   (SEQ ID NO:4)           D7S820   5′ Primer TGTCATAGTTTAGAACGAACTAACG   (SEQ ID NO:5)               3′ primer CTGAGGTATCAAAAACTCAGAGG;   (SEQ ID NO:6)           D13S317   5′ Primer ACAGAAGTCTGGGATGTGGA   (SEQ ID NO:7)               3′ primer GCCCAAAAAGACAGACAGAA;   (SEQ ID NO:8)               and           D16S539   5′ Primer GATCCCAAGCTCTTCCTCTT   (SEQ ID NO:9)               3′ primer ACGTTTGTGTGTGCATCTGT;   (SEQ ID NO:10)               and complementary sequences thereto; and                                               c) identifying the amplified DNA markers from step b), wherein the genomic DNA sample's unique combination of amplified markers represents the molecular barcode for identification of the biological sample.    
     
     
         27 . A method for identification of a biological sample of a subject undergoing diagnosis to determine whether the subject is afflicted with a particular disease or disorder, or is at risk of developing a particular disorder comprising 
 a) obtaining a genomic DNA sample from a subject;    b) performing DNA amplification of the genomic DNA sample using at least two primers for amplification of at least two DNA markers;    c) identifying the amplified DNA markers of step b), wherein the genomic DNA sample's unique combination of amplified markers represents the molecular barcode for identification of the biological sample; and    d) performing diagnosis of the subject's genomic DNA sample to determine whether the subject is afflicted with a particular disease or disorder, or is at risk of developing a particular disease or disorder, wherein the result obtained from said diagnosis step is thereby intimately associated with the molecular barcode of the sample of the subject being diagnosed.    
     
     
         28 . A method for identification of a biological sample of a subject undergoing screening for genetic lesions or mutations to determine if the subject with a lesioned gene is at risk for a disease or disorder characterized by aberrant expression or activity of a given polypeptide comprising 
 a) obtaining a genomic DNA sample from a subject;    b) performing DNA amplification of the genomic DNA sample using at least two primers for amplification of at least two DNA markers;    c) identifying the amplified DNA markers of step b), wherein the genomic DNA sample's unique combination of amplified markers represents the molecular barcode for identification of the biological sample;    d) performing screening of the subject's genomic DNA sample for detection of genetic lesions or mutations in said genomic DNA sample to determine if a subject with a lesioned gene is at risk for a disease or disorder characterized by aberrant expression or activity of a given polypeptide; wherein the result obtained from said screening step is thereby intimately associated with the molecular barcode of the sample of the subject being screened.    
     
     
         29 . A method for identification of a biological sample of a subject being diagnosed for the presence of a target microorganism comprising 
 a) obtaining a genomic DNA sample from a subject;    b) performing DNA amplification of the genomic DNA sample using at least two primers for amplification of at least two DNA markers; and    c) identifying the amplified DNA markers of step b), wherein the genomic DNA sample's unique combination of amplified markers represents the molecular barcode for identification of the biological sample; and    d) performing diagnosis of said subject to detect the presence of a target microorganism; wherein the result obtained from said diagnosis step is thereby intimately associated with the molecular barcode of the sample of the subject being diagnosed.    
     
     
         30 . A method for identification of a biological sample of a subject undergoing paternity screening, genetic screening, prenatal diagnosis, presymptomatic diagnosis, disease carrier detection, or forensic chemical analysis comprising 
 a) obtaining a genomic DNA sample from a subject;    b) performing DNA amplification of the genomic DNA sample using at least two primers for amplification of at least two DNA markers;    c) identifying the amplified DNA markers of step b), wherein the genomic DNA sample's unique combination of amplified markers represents the molecular barcode for identification of the biological sample; and    d) performing paternity screening, genetic screening, prenatal diagnosis, presymptomatic diagnosis, disease carrier detection, forensic chemical analysis, or any combination thereof, of the subject's genomic DNA sample, wherein the result obtained from said paternity screening, genetic screening, prenatal diagnosis, presymptomatic diagnosis, disease carrier detection, or forensic chemical analysis step is thereby intimately associated with the molecular barcode of the sample of the subject being screened or diagnosed.    
     
     
         31 . The method according to  claim 29 , wherein the target microorganism is selected from the group consisting of virus, bacteria, fungi or protozoa.  
     
     
         32 . The method according to  claim 31 , wherein the virus is selected from the group consisting of Human Immunodeficiency Virus Type 1 (HIV-1), Human T-Cell Lymphotrophic Virus Type 1 (HTLV-1), Hepatitis B Virus (HBV), Hepatitis C Virus (HCV), Herpes Simplex, Herpesvirus 6, Herpesvirus 7, Epstein-Barr Virus, Cytomegalo-virus, Varicella-Zoster Virus, JC Virus, Parvovirus B19, Influenza A, B and C, Rotavirus, Human Adenovirus, Rubella Virus, Human Enteroviruses, Genital Human Papillomavirus (HPV), and Hantavirus.  
     
     
         33 . The method according to  claim 31 , wherein the bacteria is selected from the group consisting of  Mycobacteria tuberculosis, Rickettsia rickettsii, Ehrlichia chaffeensis, Borrelia burgdorferi, Yersinia pestis, Treponema pallidum, Chlamydia trachomatis, Chlamydia pneumoniae, Mycoplasma pneumoniae , Mycoplasma sp.,  Legionella pneumophila, Legionella dumoffii, Mycoplasma fermentans , Ehrlichia sp.,  Haemophilus influenzae, Neisseria meningitidis, Streptococcus pneumonia, S. agalactiae , and  Listeria monocytogenes.    
     
     
         34 . The method according to  claim 31 , wherein the fungi is selected from the group consisting of  Cryptococcus neoformans, Pneumocystis carinii, Histoplasma capsulatum, Blastomyces dermatitidis, Coccidioides immitis , and  Trichophyton rubrum.    
     
     
         35 . The method according to  claim 31 , wherein the protozoa is selected from the group consisting of  Trypanosoma cruzi , Leishmania sp., Plasmodium,  Entamoeba histolytica, Babesia microti, Giardia lamblia , Cyclospora sp. and Eimeria sp.  
     
     
         36 . A method for unequivocally identifying a biological sample obtained during the screening of a plant to detect the presence of a target microorganism comprising the steps of a) obtaining a biological sample from a plant; b) detecting the presence of a target microorganism in said biological sample; and c) simultaneously identifying the DNA fingerprint of the biological sample, wherein the result obtained from the screening is associated with the unique DNA fingerprint biological barcode of the genotype of the plant being screened.  
     
     
         37 . A method for unequivocally identifying a biological sample obtained during carrier detection analysis or forensic chemical analysis of a plant comprising the steps of a) obtaining a biological sample from a plant; b) performing carrier detection analysis or forensic chemical analysis on said biological sample; and c) simultaneously identifying the DNA fingerprint of the biological sample, wherein the result obtained from said analysis is associated with the unique DNA fingerprint biological barcode of the genotype of the plant being analyzed.  
     
     
         38 . A method for unequivocally identifying a biological sample obtained during the testing of a plant to determine whether a plant is afflicted with a particular disease or condition, or is at risk of developing a particular disease or condition comprising the steps of a) obtaining a biological sample from a plant; b) testing a plant to determine whether a plant is afflicted with a particular disease or condition, or is at risk of developing a particular disease or condition; and c) simultaneously identifying the DNA fingerprint of the biological sample, wherein the result obtained from the testing is associated with the unique DNA fingerprint biological barcode of the genotype of the plant being tested.

Cited by (0)

No later patents cite this yet.

References (0)

No backward citations on record.