US2005009091A1PendingUtilityA1

Recombinational cloning using nucleic acids having recombination sites

Assignee: INVITROGEN CORPPriority: Jun 7, 1995Filed: Aug 19, 2004Published: Jan 13, 2005
Est. expiryJun 7, 2015(expired)· nominal 20-yr term from priority
C12N 15/10C12N 15/66C12N 15/64C12N 9/00
68
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Recombinational cloning is provided by the use of nucleic acids, vectors and methods, in vitro and in vivo, for moving or exchanging segments of DNA molecules using engineered recombination sites and recombination proteins to provide chimeric DNA molecules that have the desired characteristic(s) and/or DNA segment(s).

Claims

exact text as granted — not AI-modified
1 . (Canceled).  
     
     
         2 . A nucleic acid molecule comprising at least one nucleotide sequence that has at least 80-99% homology to a nucleotide sequence selected from the group of sequences consisting of:  
       
         
           
                 
                 
                 
                 
               
                     
                 
                   (a) 
                   RBYCW GCTTTYTTRTACWAA STKGD 
                   (SEQ ID NO:39) 
                     
                 
                     
                   (n-att), 
                 
                     
                 
                   (b) 
                   ASCCW GCTTTYTTRTACWAA STKGW 
                   (SEQ ID NO:40) 
                 
                     
                   (n-attB), 
                 
                     
                 
                   (c) 
                   ASCCW GCTTTYTTRTACWAA GTTGG 
                   (SEQ ID NO:41) 
                 
                     
                   (n-attL), 
                 
                     
                 
                   (d) 
                   GTTCA GCTTTYTTRTACWAA STKGW 
                   (SEQ ID NO:42) 
                 
                     
                   (n-attR), 
                 
                     
                 
                   (e) 
                   GTTCA GCTTTYTTRTACWAA GTTGG 
                   (SEQ ID NO:43) 
                 
                     
                   (n-attP), 
                 
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
       a DNA or RNA sequence corresponding to said sequences and a DNA or RNA sequence complementary to said sequences, wherein R=A or G; K=G or T/U; Y═C or T/U; W=A or T/U; D=A or G or T/U; S═C or G; and B=C or G or T/U.  
     
     
         3 . A nucleic acid molecule comprising at least one nucleotide sequence that has at least 80-99% homology to a nucleotide sequence selected from the group of sequences consisting of:  
       
         
           
                 
                 
                 
                 
               
                     
                 
                   (a) 
                   ACCCAGCTTTCTTGTACAAAGTGGT 
                   (SEQ ID NO:8) 
                     
                 
                     
                   (attB3), 
                 
                     
                 
                   (b) 
                   GTTCAGCTTTCTTGTACAAAGTGGT 
                   (SEQ ID NO:11) 
                 
                     
                   (attR3), 
                 
                     
                 
             
                
                
                
                
                
                
                
               
            
           
         
       
       a DNA or RNA sequence corresponding to said sequences and a DNA or RNA sequence complementary to said sequences.  
     
     
         4 . A nucleic acid molecule that hybridizes to the nucleic acid molecule of  claim 2 .  
     
     
         5 . A nucleic acid molecule that hybridizes to the nucleic acid molecule of  claim 3 .  
     
     
         6 . The nucleic acid molecule of any one of claims  2 - 5 , wherein said nucleic acid molecule is a vector.  
     
     
         7 . The nucleic acid molecule of any one of claims  2 - 5 , wherein said nucleic acid molecule is a primer molecule.  
     
     
         8 . The nucleic acid molecule of any one of claims  2 - 5 , wherein said nucleic acid molecule is contained within a host cell.  
     
     
         9 . The nucleic acid molecule of any one of claims  2 - 5 , wherein said nucleic acid molecule is an isolated molecule.

Join the waitlist — get patent alerts

Track US2005009091A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.