Osteogenic devices

Abstract

Disclosed are 1) osteogenic devices comprising a matrix containing osteogenic protein and methods of inducing endochondral bone growth in mammals using the devices; 2) amino acid sequence data, amino acid composition, solubility properties, structural features, homologies and various other data characterizing osteogenic proteins, 3) methods of producing osteogenic proteins using recombinant DNA technology, and 4) osteogenically and chondrogenically active synthetic protein constructs.

1 - 80 . (canceled)  
     
     
         81 . An osteogenic protein comprising one or more polypeptide chains capable of inducing endochondral bone formation when disposed within a matrix and implanted in a mammal, wherein said polyeptide chain is further characterized as having cysteine residues in the same relative positions as the cysteine skeleton sequence:  
       
         
           
                 
                 
                 
               
                     
                     
                 
                     
                   1        10        20        30        40 
                     
                 
                     
                         XXXXXXXXXXXXXXXXXXXXXXXXCXXXCXXXXX 
                 
                     
                     
                 
                     
                                 50        60        70 
                 
                     
                         XXXXXXXXXXXXXXXXXXXXXXXXXXCCXXXXXX 
                 
                     
                     
                 
                     
                            80        90        100 
                 
                     
                         XXXXXXXXXXXXXXXXXXXXXXXXXCXCX, 
                 
                     
                     
                 
             
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
       or a point mutation thereof, wherein said protein or said mutant protein is capable of inducing endochondral bone formation in a mammal, and wherein each X represents any amino acid.  
     
     
         82 . An osteogenic protein comprising one or more polypeptide chains capable of inducing endochondral bone formation when disposed within a matrix and implanted in a mammal, wherein said polypeptide chain is further characterized as having cysteine residues in the same relative positions as the cysteine skeleton sequence:  
       
         
           
                 
                 
                 
               
                     
                     
                 
                     
                   1        10        20        30        40 
                     
                 
                     
                   CXXXXXXXXXXXXXXXXXXXXXXXXXXXXCXXXCXXXXXX 
                 
                     
                     
                 
                     
                            50        60        70        80 
                 
                     
                   XXXXXXXXXXXXXXXXXXXXXXXXXCCXXXXXXXXXXXXX 
                 
                     
                     
                 
                     
                            90        100 
                 
                     
                   XXXXXXXXXXXXXXXXXXCXCX, 
                 
                     
                     
                 
             
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
       or a point mutation thereof, wherein said protein or said mutant protein is capable of inducing endochondral bone formation in a mammal, and wherein each X represents any amino acid.  
     
     
         83 . A protein, produced by expression of recombinant DNA in a host cell, comprising one or more polypeptide chains having a conformation competent to induce bone formation when combined with a matrix and implanted in a mammal, said polypeptide chain having at least 96 amino acids and less than about 200 amino acids, and having a molecular weight of approximately 14-16 kDa in an unglycosylated form or a molecular weight of approximately 16-18 kDa in a glycosylated form as determined by polyacrylamide gel electrophoresis under reducing conditions, wherein said polypeptide chain is encoded by a DNA, one strand of which hybridizes selectively to:  
       
         
           
                 
                 
               
                     
                 
                           10        20        30        40        50 
                     
                 
                   GATCCTAATGGGCTGTACGTGGACTTCCAGCGCGACGTGGGCTGGGACGA 
                 
                    D  P  N  G  L  Y  V  D  F  Q  R  D  V  G  W  D  D 
                 
                     
                 
                           60        70        80        90       100 
                 
                   CTGGATCATCGCCCCCGTCGACTTCGACGCCTACTACTGCTCCGGAGCCT 
                 
                     W  I  I  A  P  V  D  F  D  A  Y  Y  C  S  G  A 
                 
                     
                 
                           110      120       130       140       150 
                 
                   GCCAGTTCCCCTCTGCGGATCACTTCAACAGCACCAACCACGCCGTGGTG 
                 
                   C  Q  F  P  S  A  D  H  F  N  S  T  N  H  A  V  V 
                 
                     
                 
                           160      170       180       190       200 
                 
                   CAGACCCTGGTGAACAACATGAACCCCGGCAAGGTACCCAAGCCCTGCTG 
                 
                    Q  T  L  V  N  N  M  N  P  G  K  V  P  K  P  C  C 
                 
                     
                 
                           210      220       230       240       250 
                 
                   CGTGCCCACCGAGCTGTCCGCCATCAGCATGCTGTACCTGGACGAGAATT 
                 
                     V  P  T  E  L  S  A  I  S  M  L  Y  L  D  E  N 
                 
                     
                 
                           260      270       280       290       300 
                 
                   CCACCGTGGTGCTGAAGAACTACCAGGAGATGACCGTGGTGGGCTGCGGC 
                 
                   S  T  V  V  L  K  N  Y  Q  E  M  T  V  V  G  C  G 
                 
                     
                 
                           310 
                 
                   TGCCGCTAACTGCAG, 
                 
                    C  R 
                 
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
       in 5×SSPE, 10× Denhardt's mix, 0.5% SDS at 50° C., and further wherein said polypeptide chain is further characterized as having cysteine residues in the same relative positions as the cysteine skeleton sequence:  
       
         
           
                 
                 
                 
               
                     
                     
                 
                     
                   1        10        20        30        40 
                     
                 
                     
                         XXXXXXXXXXXXXXXXXXXXXXXXCXXXCXXXXX 
                 
                     
                     
                 
                     
                                 50        60        70 
                 
                     
                         XXXXXXXXXXXXXXXXXXXXXXXXXXCCXXXXXX 
                 
                     
                     
                 
                     
                            80        90        100 
                 
                     
                         XXXXXXXXXXXXXXXXXXXXXXXXXCXCX, 
                 
                     
                     
                 
             
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
       or a point mutation thereof, wherein said protein or said mutant protein is capable of inducing endochondral bone formation in a mammal, and wherein each said X is an amino acid.  
     
     
         84 . The protein of  claim 83 , wherein said polypeptide chain is further characterized as having cysteine residues in the same relative positions as the cysteine skeleton sequence:  
       
         
           
                 
                 
                 
               
                     
                     
                 
                     
                   1        10        20        30        40 
                     
                 
                     
                   CXXXXXXXXXXXXXXXXXXXXXXXXXXXXCXXXCXXXXXX 
                 
                     
                     
                 
                     
                            50        60        70        80 
                 
                     
                   XXXXXXXXXXXXXXXXXXXXXXXXXCCXXXXXXXXXXXXX 
                 
                     
                     
                 
                     
                            90        100 
                 
                     
                   XXXXXXXXXXXXXXXXXXCXCX, 
                 
                     
                     
                 
             
                
                
                
                
                
                
                
                
                
                
               
            
           
         
         or a point mutation thereof, wherein said protein or said mutant protein is capable of inducing endochondral bone formation in a mammal, and wherein each said X is an amino acid.  
       
     
     
         85 . The osteogenic protein of any one of claims  81 - 84 , wherein said protein is a dimeric protein.  
     
     
         86 . The osteogenic protein of any one of claims  81 - 84 , wherein said protein is glycosylated.  
     
     
         87 . The osteogenic protein of any one of claims  81 - 84 , wherein said protein is unglycosylated.  
     
     
         88 . A device for implantation in a mammal, comprising: 
 a biocompatible, in vivo biodegradable matrix defining pores of a dimension sufficient to permit influx, proliferation and differentiation of migratory progenitor cells from the body of said mammal; and    a substantially pure osteogenic protein comprising one or more polypeptide chains capable of inducing endochondral bone formation when disposed within a matrix and implanted in a mammal, wherein said polypeptide chain is further characterized as having cysteine residues in the same relative positions as the cysteine skeleton sequence:                                      1        10        20        30        40                   XXXXXXXXXXXXXXXXXXXXXXXXCXXXCXXXXX                                 50        60        70               XXXXXXXXXXXXXXXXXXXXXXXXXXCCXXXXXX                            80        90        100               XXXXXXXXXXXXXXXXXXXXXXXXXCXCX,                                    or a point mutation thereof, wherein said protein or said mutant protein is capable of inducing endochondral bone formation in a mammal, and wherein each X represents any amino acid.    
     
     
         89 . A device for implantation in a mammal, comprising: 
 a biocompatible, in vivo biodegradable matrix defining pores of a dimension sufficient to permit influx, proliferation and differentiation of migratory progenitor cells from the body of said mammal; and    a substantially pure osteogenic protein comprising one or more polypeptide chains capable of inducing endochondral bone formation when disposed within a matrix and implanted in a mammal, wherein said polypeptide chain is further characterized as having cysteine residues in the same relative positions as the cysteine skeleton sequence:                                      1        10        20        30        40             CXXXXXXXXXXXXXXXXXXXXXXXXXXXXCXXXCXXXXXX                            50        60        70        80         XXXXXXXXXXXXXXXXXXXXXXXXXCCXXXXXXXXXXXXX                            90        100         XXXXXXXXXXXXXXXXXXCXCX,                                    or a point mutation thereof, wherein said protein or said mutant protein is capable of inducing endochondral bone formation in a mammal, and wherein each X represents any amino acid.    
     
     
         90 . A device for implantation in a mammal, comprising: 
 a biocompatible, in vivo biodegradable matrix defining pores of a dimension sufficient to permit influx, proliferation and differentiation of migratory progenitor cells from the body of said mammal; and    a substantially pure protein, produced by expression of recombinant DNA in a host cell, comprising one or more polypeptide chains having a conformation competent to induce bone formation when combined with a matrix and implanted in a mammal, said polypeptide chain having at least 96 amino acids and less than about 200 amino acids, and having a molecular weight of approximately 14-16 kDa in an unglycosylated form or a molecular weight of approximately 16-18 kDa in a glycosylated form as determined by polyacrylamide gel electrophoresis under reducing conditions, wherein said polypeptide chain is encoded by a DNA, one strand of which hybridizes selectively to:                                  10        20        30        40        50         GATCCTAATGGGCTGTACGTGGACTTCCAGCGCGACGTGGGCTGGGACGA      D  P  N  G  L  Y  V  D  F  Q  R  D  V  G  W  D  D                   60        70        80        90       100     CTGGATCATCGCCCCCGTCGACTTCGACGCCTACTACTGCTCCGGAGCCT       W  I  I  A  P  V  D  F  D  A  Y  Y  C  S  G  A                   110      120       130       140       150     GCCAGTTCCCCTCTGCGGATCACTTCAACAGCACCAACCACGCCGTGGTG     C  Q  F  P  S  A  D  H  F  N  S  T  N  H  A  V  V                   160      170       180       190       200     CAGACCCTGGTGAACAACATGAACCCCGGCAAGGTACCCAAGCCCTGCTG      Q  T  L  V  N  N  M  N  P  G  K  V  P  K  P  C  C                   210      220       230       240       250     CGTGCCCACCGAGCTGTCCGCCATCAGCATGCTGTACCTGGACGAGAATT       V  P  T  E  L  S  A  I  S  M  L  Y  L  D  E  N                   260      270       280       290       300     CCACCGTGGTGCTGAAGAACTACCAGGAGATGACCGTGGTGGGCTGCGGC     S  T  V  V  L  K  N  Y  Q  E  M  T  V  V  G  C  G                   310     TGCCGCTAACTGCAG,      C  R                                                   in 5×SSPE, 10× Denhardt's mix, 0.5% SDS at 50° C., and further wherein    said polypeptide chain is further characterized as having cysteine residues in the same relative positions as the cysteine skeleton sequence:                                      1        10        20        30        40                   XXXXXXXXXXXXXXXXXXXXXXXXCXXXCXXXXX                                 50        60        70               XXXXXXXXXXXXXXXXXXXXXXXXXXCCXXXXXX                            80        90        100               XXXXXXXXXXXXXXXXXXXXXXXXXCXCX,                                    or a point mutation thereof, wherein said protein or said mutant protein is capable of inducing endochondral bone formation in a mammal, and wherein each said X is an amino acid.    
     
     
         91 . The device of  claim 90 , wherein said polypeptide chain is further characterized as having cysteine residues in the same relative positions as the cysteine skeleton sequence:  
       
         
           
                 
                 
                 
               
                     
                     
                 
                     
                   1        10        20        30        40 
                     
                 
                     
                   CXXXXXXXXXXXXXXXXXXXXXXXXXXXXCXXXCXXXXXX 
                 
                     
                     
                 
                     
                            50        60        70        80 
                 
                     
                   XXXXXXXXXXXXXXXXXXXXXXXXXCCXXXXXXXXXXXXX 
                 
                     
                     
                 
                     
                            90        100 
                 
                     
                   XXXXXXXXXXXXXXXXXXCXCX, 
                 
                     
                     
                 
             
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
       or a point mutation thereof, wherein said protein or said mutant protein is capable of inducing endochondral bone formation in a mammal, and wherein each said X is an amino acid.  
     
     
         92 . The device of any one of claims  88 - 91 , wherein said matrix comprises collagen and at least one material selected from the group consisting of polymers comprising lactic acid monomer units, polymers comprising glycolic acid monomer units, bone, hydroxyapatite, calcium phosphate, muscle, and tissue.  
     
     
         93 . The device of any one of claims  88 - 92 , wherein said protein is a dimeric protein.  
     
     
         94 . The device of any one of claims  88 - 92 , wherein said polypeptide is glycosylated.  
     
     
         95 . The device of any one of claims  88 - 92 , wherein said polypeptide is unglycosylated.  
     
     
         96 . A method of inducing endochondral bone formation in a mammal comprising the step of implanting the device of any one of claims  88 - 95  in said mammal at a locus accessible to migratory progenitor cells of said mammal.  
     
     
         97 . A method of inducing cartilage formation in a mammal comprising the step of implanting the device of any one of claims  88 - 95  in said mammal at a locus accessible to migratory progenitor cells of said mammal.