US2005064453A1PendingUtilityA1

Diagnostics and therapeutics for early-onset menopause

Priority: Jun 30, 1999Filed: May 3, 2004Published: Mar 24, 2005
Est. expiryJun 30, 2019(expired)· nominal 20-yr term from priority
A61P 43/00A61P 37/00A61P 29/00C12Q 2600/158G01N 33/5008A61P 1/04G01N 33/502C12Q 1/6883G01N 33/5091A61P 17/06C12Q 2600/156C12Q 2600/172C12Q 1/6827
47
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

A method of predicting whether a subject is predisposed to developing early-onset menopause is provided. The method involves genotyping a patient at the IL-1 gene loci.

Claims

exact text as granted — not AI-modified
1 . A kit for determining a woman's predisposition to early-onset menopause comprising a first primer that hybridizes 5′ or 3′ to a marker of an IL-1-related gene associated with early-onset menopause, wherein said kit is used to detect a predisposition to early-onset menopause.  
     
     
         2 . The kit of  claim 1 , wherein said marker is selected from the group consisting of: IL-1RN (+2018); IL-1RN (VNTR); IL-1A (222/223); IL-1A (gz5/gz6); IL-1A (−889); IL-1B (+3954); IL-1B (−511); gaat.p33330; Y31; IL-1RN exon 1ic (1812); IL-1RN exon 1ic (1868); IL-1RN exon 1ic (1887); Pic (1731); IL-1A (+4845); IL-1B (+6912) allele 1; and IL-1B (−31) allele 2.  
     
     
         3 . The kit as of  claim 2 , further comprising a second primer that hybridizes 3′ to said marker when said first primer hybridizes 5′ and hybridizes 5′ to said marker when said first primer hybridizes 3′.  
     
     
         4 . The kit of  claim 3 , wherein said first primer and said second primer hybridize to a region that includes said marker, wherein said region is in the range of between about 50 and 1000 base pairs.  
     
     
         5 . The kit of  claim 3 , wherein said primers are selected from the group consisting of:  
       
         
           
                 
                 
               
                     
                 
                   (SEQ ID No. 5) 
                     
                 
                 
                 
                 
               
                     
                   5′ CTC AGC AAC ACT CCT AT 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.6) 
                     
                 
                 
                 
                 
               
                     
                   5′ TCC TGG TCT GCA GGT AA 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.7) 
                     
                 
                 
                 
                 
               
                     
                   5′ CTA TCT GAG GAA CAA CCA ACT AGT AGC 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.8) 
                     
                 
                 
                 
                 
               
                     
                   5′ TAG GAC ATT GCA CCT AGG GTT TGT 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.9) 
                     
                 
                 
                 
                 
               
                     
                   5′ CTC AGG TGT CCT CGA AGA AAT CAA A 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.10) 
                     
                 
                 
                 
                 
               
                     
                   5′ GCT TTT TTG CTG TGA GTC CCG 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.11) 
                     
                 
                 
                 
                 
               
                     
                   5′ AAG CTT GTT CTA CCA CCT GAA CTA GGC 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.12) 
                     
                 
                 
                 
                 
               
                     
                   5′ TTA CAT ATG AGC CTT CCA TG 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.13) 
                     
                 
                 
                 
                 
               
                     
                   5′ TGG CAT TGA TCT GGT TCA TC 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.14) 
                     
                 
                 
                 
                 
               
                     
                   5′ GTT TAG GAA TCT TCC CAC TT 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.15) 
                     
                 
                 
                 
                 
               
                     
                   5′ ATG GTT TTA GAA ATC ATC AAG CCT AGG GCA 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.16) 
                     
                 
                 
                 
                 
               
                     
                   5′ AAT GAA AGG AGG GGA GGA TGA CAG AAA TGT 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.17) 
                     
                 
                 
                 
                 
               
                     
                   5′ TTACGCAGATAAGAACCAGTTTGG 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.18) 
                     
                 
                 
                 
                 
               
                     
                   5′ TTTCCTGGACGCTTGCTCACCAG 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.19) 
                     
                 
                 
                 
                 
               
                     
                   5′ ATGTATAGAATTCCATTCCTG 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.20) 
                     
                 
                 
                 
                 
               
                     
                   5′ TAAAATCAAGTGTTGATGTAG 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.21) 
                     
                 
                 
                 
                 
               
                     
                   5′ GGGATTACAGGCGTGAGCCACCGCG 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.22) 
                     
                 
                 
                 
                 
               
                     
                   5′ TTAGTATTGCTGGTAGTATTCATAT 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.23) 
                     
                 
                 
                 
                 
               
                     
                   5′ GAGGCGTGAGAATCTCAAGA 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.24) 
                     
                 
                 
                 
                 
               
                     
                   5′ GTGTCCTCAAGTGGATCTGG 3′; 
                     
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.25) 
                     
                 
                 
                 
                 
               
                     
                   5′ GGGCAACAGAGCAATGTTTCT 3′; 
                     
                 
                     
                   and 
                 
                     
                     
                 
                 
                 
               
                   (SEQ ID No.26) 
                     
                 
                 
                 
                 
               
                     
                   5′ CAGTGTGTCAGTGTACTGTT 3′. 
                     
                 
                     
                     
                 
             
                
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
               
            
             
                
               
            
             
                
                
                
               
            
             
                
               
            
             
                
                
               
            
           
         
       
     
     
         6 . The kit of  claim 2 , further comprising a DNA sampling means.  
     
     
         7 . The kit of  claim 2 , further comprising a control.  
     
     
         8 . The kit of  claim 2 , further comprising a DNA detection means.  
     
     
         9 . The kit of  claim 3 , wherein said first primer and/or said second primer further comprises a detectable label.

Join the waitlist — get patent alerts

Track US2005064453A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.