Combined chemotherapy compositions and methods for the treatment of cancer, ischemia-reperfusion injury, and septic shock

Abstract

Covalently reactive antigen analogs are disclosed herein. The antigens of the invention may be used to stimulate production of catalytic antibodies specific for predetermined antigens assocated with particular medical disorders. The antigen analogs may also be used to permanently inactivate endogenously produced catalytic antibodies produced in certain autoimmune diseases as well as in certain lymphoproliferative disorders.

1 - 13 . (canceled)  
     
     
         14 . A method for treating a disease state in a patient comprising administering a therapeutically effective amount of a catalytic antibody in combination with a therapeutically effective amount of an agent which blocks programmed cell death.  
     
     
         15 . The method of  claim 14 , wherein said disease state is selected from the group consisting of ischemia and reperfusion injury, septic shock, systemic inflammatory response syndrome (SIRS), acute respiratory distress syndrome (ARDS), inflammatory disorders, rheumatoid arthritis, inflammatory bowel disease, multiple sclerosis, and neurotrophic pain.  
     
     
         16 . The method of  claim 15 , wherein said catalytic antibody is selected from the group consisting of antibodies specific for p53, p21, p27 and at least one inflammatory mediator or its receptor, and said agent which blocks programmed cell death is selected from the group consisting of p53 antisense oligonucleotides, p27 antisense oligonucleotides, p21 antisense oligonucleotides.  
     
     
         17 . The method of  claim 16 , wherein said catalytic antibody is specific for an inflammatory mediator or its receptor selected from the group consisting of interleukin-1 (IL-1), IL-1β, IL-4, tumor necrosis factor alpha (TNFα), IL-1 receptor, IL-4 receptor, and TNFα receptor and said agent which blocks programmed cell death is a p53 antisense oligonucleotide.  
     
     
         18 . The method of  claim 17 , wherein said p53 antisense oligonucleotide is OL(1)p53.  
     
     
         19 . A method for treating cancer in a patient comprising administering a therapeutically effective amount of a catalytic antibody in combination with a therapeutically effective amount of a cell cycle check point inhibitor.  
     
     
         20 . The method of  claim 19 , wherein said catalytic antibody is specific for at least one neoplastic antigen or its receptor.  
     
     
         21 . The method of  claim 20  wherein said neoplastic antigen is selected from the group consisting of epidermal growth factor (EGF), transforming growth factor alpha (TGFα), p53 products, prostate specific antigen, carcinoembryonic antigen, prolactin, human chorionic gonadotropin, c-myc, c-fos, c-jun, p-glycoproteins, multidrug resistance associated proteins, metalloproteinases, angiogenesis factors, epidermal growth factor receptor (EGFR), HER-2, prolactin receptors, and steroid receptors.  
     
     
         22 . The method of  claim 21 , wherein said cell cycle checkpoint inhibitor is selected from the group consisting of at least one of p53 antisense oligonucleotides, UCN-01 (7-hydroxystaurosporine), pentoxifylline, lisofylline, p21 antisense oligonucleotides, p27 antisense oligonucleotides, GADD45 antisense oligonucleotides, and catalytic antibodies specific for p53, p21, or p27.  
     
     
         23 . The method of  claim 22 , wherein said cell cycle checkpoint inhibitor is a p53 antisense oligonucleotide.  
     
     
         24 . The method of  claim 22 , wherein said p53 antisense oligonucleotide is OL(1)p53.  
     
     
         25 . The method of  claim 19 , further comprising administering a therapeutically effective amount of an anti-cancer agent capable of causing genomic damage.  
     
     
         26 . The method of  claim 25 , wherein said anti-cancer agent is selected from the group consisting of γ-irradiation, camptothecan, topoisomerase inhibitors, alkylating agents, anthracyclines, spindle poisons, antimetabolites, and chemotherapeutic agents.  
     
     
         27 . The method of  claim 26 , wherein said chemotherapeutic agents are selected from the group consisting of doxorubicin, etoposide, and cisplatin.  
     
     
         28 . The method of  claim 22 , wherein said catalytic antibody is specific for a receptor selected from the group consisting of epidermal growth factor receptor and Her2 receptor.  
     
     
         29 . The method of  claim 28 , further comprising administration of at least one agent selected from the group consisting of UCN-01, pentoxifylline, lisophylline, GADD45 antisense oligonucleotides, an anti-EGFR mononclonal antibody and an anti-HER2 monoclonal antibody.  
     
     
         30 . A method for the treatment of cancer comprising the administration of a catalytic antibody specific for a neoplastic antigen selected from the group consisting of epidermal growth factor (EGF), transforming growth factor alpha (TGFα), p53 products, prostate specific antigen, carcinoembryonic antigen, prolactin, human chorionic gonadotropin, c-myc, c-fos, c-jun, p-glycoproteins, multidrug resistance associated proteins, metalloproteinases, angiogenesis factors, epidermal growth factor receptor (EGFR), HER-2, prolactin receptors, and steroid receptors and an OL-1 p53 antisense oligonucleotide having the sequence of 5′CCCTGCTCCCCCCTGGCTCC 3′ (SEQ ID NO: 11).  
     
     
         31 . The method as claimed in  claim 30 , further comprising administration of an agent selected from the group consisting of an EGFR inhibitor and a HER2 receptor inhibitor.