Immunostimulatory nucleic acids for the treatment of asthma and allergy

Abstract

The invention involves administration of an immunostimulatory nucleic acid alone or in combination with an asthma/allergy medicament for the treatment or prevention of asthma and allergy in subjects. The combination of drugs are administered in synergistic amounts or in various dosages or at various time schedules. The invention also relates to kits and compositions concerning the combination of drugs.

1 - 36 . (canceled)  
     
     
         37 . A method for treating or preventing airway remodeling in a hypo-responsive subject having asthma, the method comprising administering to the subject an immunostimulatory nucleic acid in an amount effective to treat or prevent the airway remodeling.  
     
     
         38 . A method for treating or preventing lung fibrosis in a hypo-responsive subject having asthma, the method comprising administering to the subject an immunostimulatory nucleic acid in an amount effective to treat or prevent the lung fibrosis.  
     
     
         39 . The method of  claim 37  or  claim 38 , wherein the immunostimulatory nucleic acid is a CpG nucleic acid.  
     
     
         40 . The method of  claim 37  or  claim 38 , wherein the CpG nucleic acid is represented by at least the formula 5′X 1 X 2 CGX 3 X 4 3′, wherein X 1 , X 2 , X 3 , and X 4  are nucleotides.  
     
     
         41 . The method of  claim 37  or  claim 38 , wherein X 2  is adenine, guanine, cytosine, or thymine.  
     
     
         42 . The method of  claim 37  or  claim 38 , wherein X 2  is thymine.  
     
     
         43 . The method of  claim 37  or  claim 38 , wherein X 3  is cytosine, guanine, adenine, or thymine.  
     
     
         44 . The method of  claim 37  or  claim 38 , wherein X 2  is adenine, guanine, or thymine and wherein X 3  is cytosine, adenine, or thymine.  
     
     
         45 . The method of  claim 37  or  claim 38 , wherein the immunostimulatory nucleic acid is an isolated CpG nucleic acid represented by at least the formula 5′ N 1 X 1 X 2 CGX 3 X 4 N 2 3′, wherein X 1 , X 2 , X 3 , and X 4  are nucleotides, N is any nucleotide, and N 1  and N 2  are nucleic acid sequences composed of 0-25 nucleotides each.  
     
     
         46 . The method of  claim 37  or  claim 38 , wherein X 1 X 2  are nucleotides selected from the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, CpG, TpA, TpT, and TpG; and X 3 X 4  are nucleotides selected from the group consisting of: TpT, ApT, TpG, ApG, CpG, TpC, ApC, CpC, TpA, ApA, and CpA.  
     
     
         47 . The method of  claim 37  or  claim 38 , wherein X 1 X 2  is GpA or GpT and wherein X 3 X 4  is TpT.  
     
     
         48 . The method of  claim 37  or  claim 38 , wherein X 1  or X 2  or both X 1  and X 2  are purines and wherein X 3  or X 4  or both X 3  and X 4  are pyrimidines.  
     
     
         49 . The method of  claim 37  or  claim 38 , wherein X 1 X 2  is GpA and wherein X 3  or X 4  or both X 3  and X 4  are pyrimidines.  
     
     
         50 . The method of  claim 37  or  claim 38 , wherein X 1 X 2  is selected from the group consisting of: TpA, ApA, ApC, ApG, and GpG.  
     
     
         51 . The method of  claim 37  or  claim 38 , wherein X 3 X 4  is selected from the group consisting of: TpT, TpA, TpG, ApA, ApG, ApC, and CpA.  
     
     
         52 . The method of  claim 37  or  claim 38 , wherein X 1 X 2  is selected from the group consisting of: TpT, TpG, ApT, GpC, CpC, CpT, TpC, GpT and CpG.  
     
     
         53 . The method of  claim 37  or  claim 38 , wherein the immunostimulatory nucleic acid has a sequence provided as AATAGTCGCCATCGCGCGAC (SEQ ID NO:367).  
     
     
         54 . The method of  claim 37  or  claim 38 , wherein the immunostimulatory nucleic acid is administered to the subject by a route selected from intranasal, intratracheal, and inhalation.  
     
     
         55 . The method of  claim 37  or  claim 38 , wherein the immunostimulatory nucleic acid is administered intranasally.  
     
     
         56 . The method of  claim 37  or  claim 38 , wherein the immunostimulatory nucleic acid is administered systemically.  
     
     
         57 . The method of  claim 37  or  claim 38 , further comprising administering an anti-inflammatory agent.  
     
     
         58 . The method of  claim 37  or  claim 38 , further comprising administering a corticosteroid.  
     
     
         59 . The method of  claim 58 , wherein the corticosteroid is selected from the group consisting of methylprednisolone, prednisolone, and prednisone.  
     
     
         60 . A pharmaceutical formulation for treatment of lung fibrosis, comprising: 
 a therapeutically effective amount of an immunostimulatory CpG nucleic acid in an aerosol spray for administration by inhalation.    
     
     
         61 . The pharmaceutical formulation of  claim 60 , wherein the immunostimulatory CpG nucleic acid is delivered from a pressurized pack or nebulizer with the use of a propellant.  
     
     
         62 . The pharmaceutical formulation of  claim 60 , wherein the immunostimulatory nucleic acid is formulated in a metered dose inhaler.  
     
     
         63 . The method of any one of claims  37 ,  38 , or  60 , wherein the immunostimulatory nucleic acid has a modified backbone.  
     
     
         64 . The method of  claim 63 , wherein the modified backbone is a phosphate modified backbone.  
     
     
         65 . The method of  claim 63 , wherein the modified backbone is a phosphorothioate modified backbone.