Superoxide dismutase (SOD) gene and a method of identifying and cloning thereof

Abstract

The present invention provides a superoxide dismutase gene from Potentilla atrosanguinea, a construct containing the gene coding for superoxide dismutase and transformed E.coli producing the SOD protein.

1 . Superoxide dismutase (SOD) cDNA of SEQ ID No. 2 obtained from  Potentilla atrosanguinea,  wherein the said cDNA comprising of 856 nucleotide bases.  
     
     
         2 . Superoxide dismutase (SOD) cDNA as claimed in  claim 1 , wherein the said cDNA has entire coding sequence along with pre- and post-coding sequences.  
     
     
         3 . Superoxide dismutase (SOD) gene coding cDNA of SEQ ID No. 3, wherein the said coding cDNA comprising of 459 nucleotide bases.  
     
     
         4 . Superoxide dismutase (SOD) polypeptide of SEQ ID No. 1, wherein the said polypeptide comprising of 152 amino acids.  
     
     
         5 . Superoxide dismutase (SOD) polypeptide as claimed in  claim 4 , wherein the said polypeptide is autoclavable.  
     
     
         6 . Superoxide dismutase (SOD) polypeptide as claimed in  claim 4 , wherein the said polypeptide is functional at temperature range of <−10° C. to +80° C.  
     
     
         7 . A set of primers useful for the amplification of Superoxide dismutase (SOD) gene coding cDNA of SEQ ID No. 3, wherein 
 Forward primer 5′-ATGGCAAAGGGCGTTGCTGTACTT-3′ (SEQ ID NO: 5) and;    Rreverse primer 5′-TCATCCTTGMGGCCMTMTACCA-3′ (SEQ ID NO: 6)    
     
     
         8 . A method of identifying and cloning of superoxide dismutase (SOD) gene of SEQ ID NO 3 which codes for a polypeptide of SEQ ID No. 1 having Superoxide dismutase enzyme activity, wherein the said method comprising the steps of: 
 a) isolating the mRNA from leaves of  potentialla;      b) synthesizing the cDNA from mRNA as obtained from step (a);    c) constructing a cDNA library of the DNA of  potentilla  followed by the cloning of the cDNA obtained from step (b) in a suitable vector preferably in bacteriophage;    d) screening the said library obtained from step (c) followed by the primary, secondary and tertiary screening for identification of positive cDNA clones;    e) isolating the DNA from positive cDNA clones obtained from step (d);    f) amplifying the said DNA using the primers comprising:                                          Forward Primer:                 5′-GTTGTAAAACGACGTGCCAGT-3′   (SEQ ID NO: 13)                   Reverse Primer:         5′-CACAGGAAACAGCTATGACC-3′;   (SEQ ID NO: 14)                                 h) amplifying the ends of cDNA obtained from step (e) through rapid amplification of cDNA ends technique (RACE) using different set of primers to get the full length desired Superoxide dismutase (SOD) DNA of SEQ ID NO. 2 wherein the said primers comprising:                                      Forward Primer (GSP1):                           (SEQ ID NO: 7)                           5′-CCAGTGGATTTGCTAAGCTCATGTCCA-3′                       Reverse Primer (NES1):                       (SEQ ID NO: 8)                           5′-GTCATCAGGGTCTGCATGGACAACAAC-3′                       Forward Primer (GSP2):                       (SEQ ID NO: 9)                           5′-ATGGTTGCATGTCAACTGGACCACATT-3′                       Reverse Primer (NES2):                       (SEQ ID NO: 10)                           5′-TTGCATGTCAACTGGACCACATTTCAA-3′                       SMART II A Oligonucleotide:                       (SEQ ID NO: 11)                           5′AAGCAGTGGTATCAACGCAGAGTAC GCGGG-3′                       3′- RACE CDS Primer A (3′- CDS):                       (SEQ ID NO: 73)                           5′AAGCAGTGGTATCAACGCAGA             GTAC (T) 30  N −1 N-3′                   5′- RACE CDS Primer (5′- CDS)                       (SEQ ID NO: 15)                           5′- (T) 25  N −1 N- 3′                       Universel Primer Mix A (UPM): Long:                       (SEQ ID NO: 16)                           5′TAATACGACTCACTATAGGGC             AAGCAGTG GTATCAACGCAGAGT-3′                   Universel Primer Mix A (UPM): Short:                       (SEQ ID NO: 17)                           5′-CTAATACGACTCACTATAGG             GC-3′                   Nested Universal Primer A (NUP):                       (SEQ ID NO: 23)                           5′-AAGCAGTGGTATCAACGCAGAGT-3′                                                                                                                                                                              i) amplifying the coding sequence of Superoxide dismutase (SOD) of SEQ ID No. 3 using a set of primers designed from start and stop codon of full length desired Superoxide dismutase (SOD) DNA of SEQ ID NO. 2 wherein the said primers have the following sequences:                              Forward Primer:             5′-ATGGCAAAGGGCGTTGCTGTACTT-3′   (SEQ ID NO: 5)           Reverse Primer:     5′-TCATCCTTGAAGGCCAATAATACCA-3′   (SEQ ID NO: 6)                             j) cloning the amplified product obtained from step (g) into pQE 30 expression vector followed by the transformation it into competent  E.coli  cells to get an expression construct;    k) isolating the plasmid DNA by conventional method followed by sequencing to confirm the said SOD gene.    
     
     
         9 . A method as claimed in  claim 9 , wherein the polyclonal antibodies were raised against the purified SOD and used for cDNA library screening synthesized from young leaf mRNA.  
     
     
         10 . A method as claimed in  claim 9 , wherein the 10 5  plaque forming units (pfu) are taken for primary screening.  
     
     
         11 . A method as claimed in  claim 11 , wherein three strong positive clones are obtained from the primary cloning.  
     
     
         12 . A method as claimed in  claim 12 , wherein the said positive clones are taken for secondary screening which gives about 70% positive clones.  
     
     
         13 . A method as claimed in  claim 13 , wherein the said positive clones are randomly taken for tertiary screening which gives 100% positive signal after tertiary screening.  
     
     
         14 . A method as claimed in  claim 9 , wherein the said RACE Primers are designed such that the amplified 5′ and 3′end overlap each other over a small stretch of nucleotides.  
     
     
         15 . A method as claimed in  claim 9 , wherein the said full length SOD gene of SEQ ID No. 2 contains 856 nucleotide bases.  
     
     
         16 . A method as claimed in  claim 16 , wherein the said full length SOD gene of SEQ ID No. 2 has entire coding sequence along with pre- and post-coding sequences  
     
     
         17 . A method as claimed in  claim 9 , wherein the said coding cDNA of SEQ ID No. 3 comprises 459 nucleotide bases.  
     
     
         18 . A method as claimed in  claim 18 , wherein the said coding sequence of SOD gene of SEQ ID No. 3 corresponding to polynucleotides encoding Superoxide dismutase (SOD) enzyme.  
     
     
         19 . An expression construct comprises a nucleotide sequence of superoxide dismutase (SOD) gene of SEQ ID NO 3 which codes for a polypeptide of SEQ ID No. 1 having Superoxide dismutase enzyme activity, a selectable marker and a terminator sequence.