Nucleic acid sequences for detecting genetic markers for cancer in a biological sample

Abstract

Nucleic acid sequences for detecting the presence of nucleic acids, particularly mRNA, encoding human prostate-associated genetic markers encoding prostate-specific antigen (PSA), prostate specific membrane antigen (PSMA) or human kallikrein 2 (hK2) are disclosed. Preferred combinations of nucleic acid sequences amplifying and detecting the prostate-associated genetic markers RNA, used in methods that include amplification of the target sequences and detection of the amplified sequences are disclosed. Methods of detecting the presence of prostate-associated genetic marker nucleic acids, particularly mRNA, in a biological sample of non-prostate origin are disclosed.

1 . An isolated oligonucleotide comprising: 
 a sequence consisting of a target-binding sequence of SEQ ID NO:37 (GCCGACCCAGCAAGATCACGC) or its equivalent RNA, or a fully complementary sequence of the target-binding sequence of SEQ ID NO:37 or its equivalent RNA, and    an optional 5′ promoter sequence adjacent to the target-binding sequence.    
     
     
         2 . An isolated oligonucleotide consisting essentially of the sequence of SEQ ID NO:37, or a fully complementary base sequence or equivalent RNA of SEQ ID NO:37.  
     
     
         3 . An oligonucleotide according to  claim 1 , consisting essentially of a target-binding sequence of SEQ ID NO:37 (GCCGACCCAGCAAGATCACGC) without a 5′ promoter sequence.  
     
     
         4 . A combination of oligonucleotides used in a detection assay specific for a prostate specific antigen (PSA) target nucleic acid sequence, comprising: 
 a first oligonucleotide made of a sequence consisting essentially of a target-binding sequence of SEQ ID NO:37 (GCCGACCCAGCAAGATCACGC) or its equivalent RNA, or a fully complementary base sequence of the target-binding sequence of SEQ ID NO:37 or its equivalent RNA and an optional 5′ promoter sequence adjacent to the target-binding sequence that serves as a first amplification primer that hybridizes specifically to a first PSA-specific sequence contained in exon 3 of a PSA expressed gene sequence;    a second oligonucleotide consisting essentially of SEQ ID NO:20, or a fully complementary base sequence or equivalent RNA thereof, that serves as a second amplification primer that hybridizes specifically to a different, non-overlapping second PSA-specific sequence contained in exon 2 of a PSA expressed gene sequence; and    a third oligonucleotide that serves as a detection probe that hybridizes specifically to a third PSA-specific sequence contained in one or more exons of a PSA expressed gene sequence, wherein the third PSA-specific sequence is located between the first PSA-specific sequence and the second PSA-specific sequence.    
     
     
         5 . The combination of oligonucleotides of  claim 4 , wherein the third oligonucleotide hybridizes specifically to a third PSA-specific sequence contained in exon 2 of a PSA expressed gene sequence.  
     
     
         6 . The combination of oligonucleotides of  claim 4 , wherein the third oligonucleotide consists essentially of SEQ ID NO:8 or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:8 or its equivalent RNA.  
     
     
         7 . A method of detecting a prostate-associated target nucleic acid in a biological sample containing nucleic acid, comprising the steps of: 
 providing a nucleic acid sample containing a target nucleic acid that includes at least a portion of at least one expressed gene sequence encoding prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA) or human kallikrein 2 (hK2);    hybridizing to the target nucleic acid in a PSA genetic sequence a first oligonucleotide that includes a sequence consisting essentially of a target-binding sequence of SEQ ID NO:37 (GCCGACCCAGCAAGATCACGC) or its equivalent RNA, or a fully complementary base sequence of the target-binding sequence of SEQ ID NO:37 or its equivalent RNA and an optional 5′ promoter sequence adjacent to the target-binding sequence that serves as a first amplification primer;    hybridizing to the target nucleic acid or a complementary strand of the target nucleic acid in the PSA genetic sequence a second oligonucleotide consisting essentially of SEQ ID NO:20 or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:20 or its equivalent RNA, that serves as a second amplification primer;    producing a plurality of amplification products of the target nucleic acid by using the first and second amplification primers and at least one polymerase activity;    providing a probe oligonucleotide that hybridizes specifically to at least one amplification product of nucleic acid in the PSA genetic sequence; and    detecting a signal resulting from the probe hybridized to the amplification product.    
     
     
         8 . The method of  claim 7 , wherein the probe oligonucleotide hybridizes specifically to a sequence of exon 2 of the gene sequence encoding PSA.  
     
     
         9 . The method of  claim 8 , wherein the probe oligonucleotide consists essentially of SEQ ID NO:8.  
     
     
         10 . The method of  claim 7 , wherein a nucleic acid specific for the prostate-specific membrane antigen (PSMA) is also detected.  
     
     
         11 . The method of  claim 10 , wherein the nucleic acid specific for PSMA is detected by using a combination of oligonucleotides consisting of SEQ ID NO:48, SEQ ID NO:49, and SEQ ID NO:50.  
     
     
         12 . The method of  claim 7 , wherein a nucleic acid specific for the human kallikrein 2 (hK2) is also detected.  
     
     
         13 . The method of  claim 12 , wherein the nucleic acid specific for hK2 is detected by using a combination of oligonucleotides consisting of SEQ ID NO:46, SEQ ID NO:47, and SEQ ID NO:1.