US2009004169A1PendingUtilityA1

Nucleic Acids For Inhibiting Hairless Protein Expression and Methods of Use Thereof

69
Assignee: CHRISTIANO ANGELA MPriority: Apr 13, 2001Filed: Jun 16, 2008Published: Jan 1, 2009
Est. expiryApr 13, 2021(expired)· nominal 20-yr term from priority
A61K 38/00C12N 15/113C12N 2310/12A61P 17/00A61P 17/14
69
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The present invention provides DNAzymes and ribozymes that specifically cleave Hairless protein mRNA. The present invention also provides antisense oligonucleotides that specifically inhibit translation of Hairless Protein mRNA. The present invention also provides various methods of inhibiting the expression of Hairless Protein. Finally the invention provides pharmaceutical compositions containing the instant DNAzymes, ribozymes and antisense oligonucleotides as active ingredients.

Claims

exact text as granted — not AI-modified
1 . A catalytic deoxyribonucleic acid molecule that specifically cleaves Hairless Protein mRNA comprising:
 (a) a catalytic domain that cleaves mRNA at a defined consensus sequence;   (b) a binding domain contiguous with the 5′ end of the catalytic domain; and   (c) a binding domain contiguous with the 3′ end of the catalytic domain,   wherein the binding domains are complementary to, and therefore hybridize with, the two regions flanking the defined consensus sequence within the Hairless Protein mRNA at which cleavage is desired, and wherein each binding domain is at least 4 residues in length and both binding domains have a combined total length of at least 8 residues, and wherein the catalytic domain has the sequence ggctagctacaacga (SEQ ID NO: 18), and cleaves mRNA at the consensus sequence purine:pyrimidine.   
     
     
         2 . The catalytic deoxyribonucleic acid molecule of  claim 1 , wherein the molecule has a sequence selected from the group consisting of: 
       
         
           
                 
                 
                 
                 
               
                   (a) 
                   cggcccaggctagctacaacgaggtgcag; 
                   (SEQ ID NO:3) 
                     
                 
                     
                 
                   (b) 
                   ctcaggaggctagctacaacgagcccctc; 
                   (SEQ ID NO:4) 
                 
                     
                 
                   (c) 
                   gggagcaggctagctacaacgagtccttg; 
                   (SEQ ID NO:5) 
                 
                     
                 
                   (d) 
                   ctccccaggctagctacaacgatctgggg; 
                   (SEQ ID NO:6) 
                 
                     
                 
                   (e) 
                   cagccagggctagctacaacgatgacctt; 
                   (SEQ ID NO:7) 
                 
                     
                 
                   (f) 
                   cagcggaggctagctacaacgagggtaag; 
                   (SEQ ID NO:8) 
                 
                     
                 
                   (g) 
                   cgcagaaggctagctacaacgagccagcg; 
                   (SEQ ID NO:9) 
                 
                     
                 
                   (h) 
                   tgcggggggctagctacaacgacaggggc; 
                   (SEQ ID NO:10) 
                 
                     
                 
                   (i) 
                   aggggtgggctagctacaacgaggggtca; 
                   (SEQ ID NO:11) 
                 
                     
                 
                   (j) 
                   cccggagggctagctacaacgaataccca; 
                   (SEQ ID NO:12) 
                 
                     
                 
                   (k) 
                   gcctaagggctagctacaacgatgaaggc; 
                   (SEQ ID NO:13) 
                 
                     
                 
                   (l) 
                   gcaaggaggctagctacaacgatctgctg; 
                   (SEQ ID NO:14) 
                 
                     
                 
                   (m) 
                   gttcccaggctagctacaacqacgcctgg; 
                   (SEQ ID NO:15) 
                 
                     
                 
                   (n) 
                   cagctggggctagctacaacgaacccaag; 
                   (SEQ ID NO:16) 
                 
                   and 
                 
                     
                 
                   (o) 
                   cccatggggctagctacaacgagcagtcc. 
                   (SEQ ID NO:2) 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         3 . A catalytic ribonucleic acid molecule that specifically cleaves Hairless Protein mRNA comprising:
 (a) a catalytic domain that cleaves mRNA at a defined consensus sequence;   (b) a binding domain contiguous with the 5′ end of the catalytic domain; and   (c) a binding domain contiguous with the 3′ end of the catalytic domain,   wherein the binding domains are complementary to, and therefore hybridize with, the two regions flanking the defined consensus sequence within the Hairless Protein mRNA at which cleavage is desired, and wherein each binding domain is at least 4 residues in length and both binding domains have a combined total length of at least 8 residues, and wherein the catalytic domain has the sequence CTGATGAGTCCGTGAGGACGAAACA (SEQ ID NO: 19), and cleaves mRNA at the consensus sequence 5′-NUH-3′.   
     
     
         4 . The catalytic ribonucleic acid molecule of  claim 3 , wherein the molecule is a hammerhead ribozyme or a hairpin ribozyme. 
     
     
         5 . The catalytic ribonucleic acid molecule of  claim 3 , wherein the molecule has a sequence selected from the group consisting of: 
       
         
           
                 
                 
                 
                 
               
                   (a) 
                   cggccggcgggcgagctgatgagtccgtgagg 
                   (SEQ ID NO:20) 
                     
                 
                     
                   acgaaacacgcgttctcccgctct; 
                 
                     
                 
                   (b) 
                   gagtctggggtgctcagctgatgagtccgtga 
                   (SEQ ID NO:21) 
                 
                     
                   ggacgaaacacgcccctccaaaagg; 
                 
                     
                 
                   (c) 
                   ttgctgcccagccagttctgatgagtccgtga 
                   (SEQ ID NO:22) 
                 
                     
                   ggacgaaacaccttcctctccccatt; 
                 
                     
                 
                   (d) 
                   gctctgggggcaggccactgatgagtccgtga 
                   (SEQ ID NO:23) 
                 
                     
                   ggacgaaaca cactaggtagggtggc; 
                 
                     
                 
                   (e) 
                   atgaacaaggcctggggctgatgagtccgtga 
                   (SEQ ID NO:24) 
                 
                     
                   ggacgaaaca caagcgggccaggagg; 
                 
                   and 
                 
                     
                 
                   (f) 
                   tcgcctggcccagcccactgatgagtccgtga 
                   (SEQ ID NO:25) 
                 
                     
                   ggacgaaaca cgttgccaagagtatg. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         6 . The catalytic nucleic acid molecule of  claim 1  or  3 , wherein the cleavage site within the Hairless protein mRNA is located within the first 1500 residues following the mRNA's 5′ terminus. 
     
     
         7 . The catalytic nucleic acid molecule of  claim 1  or  3 , wherein the Hairless Protein mRNA is from a subject selected from the group consisting of human, monkey, rat and mouse. 
     
     
         8 . The catalytic nucleic acid molecule of  claim 1  or  3 , wherein the Hairless protein mRNA has the sequence of SEQ ID NO:1. 
     
     
         9 . A pharmaceutical composition comprising the catalytic nucleic acid molecule of  claim 1  or  3  and a pharmaceutically acceptable carrier. 
     
     
         10 . The pharmaceutical composition of  claim 9 , wherein the carrier is selected from the group consisting of an alcohol, an ethylene glycol and a liposome. 
     
     
         11 . A method of specifically cleaving Hairless Protein mRNA comprising contacting the mRNA with the catalytic nucleic acid molecule of  claim 1  or  3  under conditions permitting the molecule to cleave the mRNA. 
     
     
         12 . A method of specifically cleaving Hairless Protein mRNA in a cell, comprising contacting the cell containing the mRNA with the catalytic nucleic acid molecule of  claim 1  or  3  so as to specifically cleave the Hairless Protein mRNA in the cell. 
     
     
         13 . A method of specifically inhibiting the expression of Hairless Protein in a cell that would otherwise express Hairless Protein, comprising contacting the cell with the catalytic nucleic acid molecule of  claim 1  or  3  so as to specifically inhibit the expression of Hairless Protein in the cell. 
     
     
         14 . A method of specifically inhibiting the expression of Hairless Protein in a subject's cells, comprising administering to the subject an amount of the catalytic nucleic acid molecule of  claim 1  or  3  effective to specifically inhibit the expression of Hairless Protein in the subject's cells. 
     
     
         15 . A method of specifically inhibiting the expression of Hairless Protein in a subject's cells comprising administering to the subject an amount of the pharmaceutical composition of  claim 9  effective to specifically inhibit the expression of Hairless Protein in the subject's cells. 
     
     
         16 . A method of inhibiting hair production by a hair-producing cell comprising contacting the cell with an effective amount of the catalytic nucleic acid of  claim 1  or  3 . 
     
     
         17 . A method of inhibiting hair growth in a subject comprising administering to the subject an effective amount of the pharmaceutical composition of  claim 9 . 
     
     
         18 . A method of inhibiting the transition of a hair follicle from the anagen phase to the catagen phase comprising contacting the follicle with an effective amount of the catalytic nucleic acid of  claim 1  or  3 . 
     
     
         19 . A method of inhibiting the transition of a hair follicle from the anagen phase to the catagen phase comprising contacting the follicle with an effective amount of the pharmaceutical composition of  claim 9 . 
     
     
         20 . The method of  claim 12 , wherein the cell is a keratinocyte. 
     
     
         21 . The method of  claim 13 , wherein the cell is a keratinocyte. 
     
     
         22 . The method of  claim 14 , wherein the cell is a keratinocyte. 
     
     
         23 . The method of  claim 15 , wherein the cell is a keratinocyte. 
     
     
         24 . The method of  claim 14  wherein the subject is a human. 
     
     
         25 . The method of  claim 15 , wherein the subject is a human. 
     
     
         26 . The method of  claim 17 , wherein the subject is a human. 
     
     
         27 . The method of  claim 14 , wherein the catalytic nucleic acid molecule is administered topically. 
     
     
         28 . The method of  claim 27 , wherein the catalytic nucleic acid molecule is administered dermally. 
     
     
         29 . The method of  claim 15 , wherein the pharmaceutical composition is administered topically. 
     
     
         30 . The method of  claim 29 , wherein the pharmaceutical composition is administered dermally. 
     
     
         31 . The method of  claim 17 , wherein the pharmaceutical composition is administered topically. 
     
     
         32 . The method of  claim 31 , wherein the pharmaceutical composition is administered dermally. 
     
     
         33 . A vector which comprises a sequence encoding the catalytic nucleic acid molecule of  claim 1  or  3 . 
     
     
         34 . A host-vector system comprising a cell having the vector of  claim 33  therein. 
     
     
         35 . A method of producing the catalytic nucleic acid molecule of  claim 1  or  3  comprising culturing a cell having therein a vector comprising a sequence encoding said catalytic nucleic acid molecule under conditions permitting the expression of the catalytic nucleic acid molecule by the cell. 
     
     
         36 . A nucleic acid molecule that specifically hybridizes to Hairless Protein mRNA so as to inhibit the translation thereof in a cell, wherein the nucleic acid molecule comprises consecutive nucleotides having the sequence of SEQ ID NO:27. 
     
     
         37 . A vector that comprises a sequence encoding the nucleic acid molecule of  claim 36 . 
     
     
         38 . A host-vector system comprising a cell having the vector of  claim 37  therein. 
     
     
         39 . A pharmaceutical composition comprising (a) the nucleic acid molecule of  claim 36  or the vector of  claim 37  and (b) a pharmaceutically acceptable carrier. 
     
     
         40 . The pharmaceutical composition of  claim 39 , wherein the carrier is selected from the group consisting of an alcohol, ethylene glycol and a liposome. 
     
     
         41 . A method of specifically inhibiting the expression of Hairless Protein in a cell that would otherwise express Hairless Protein, comprising contacting the cell with the nucleic acid molecule of  claim 36  so as to specifically inhibit the expression of Hairless Protein in the cell. 
     
     
         42 . A method of specifically inhibiting the expression of Hairless Protein in a subject's cells comprising administering to the subject an amount of the nucleic acid molecule of  claim 36  effective to specifically inhibit the expression of Hairless Protein in the subject's cells. 
     
     
         43 . A method of specifically inhibiting the expression of Hairless Protein in a subject's cells comprising administering to the subject an amount of the pharmaceutical composition of  claim 39  effective to specifically inhibit the expression of Hairless Protein in the subject's cells. 
     
     
         44 . A method of inhibiting hair production by a hair-producing cell comprising contacting the cell with an effective amount of the nucleic acid molecule of  claim 36 . 
     
     
         45 . A method of inhibiting hair growth in a subject comprising administering to the subject an effective amount of the pharmaceutical composition of  claim 39 . 
     
     
         46 . A method of inhibiting the transition of a hair follicle from the anagen phase to the catagen phase comprising contacting the follicle with an effective amount of the nucleic acid molecule of  claim 36 . 
     
     
         47 . A method of inhibiting the transition of a hair follicle from the anagen phase to the catagen phase comprising contacting the follicle with an effective amount of the pharmaceutical composition of  claim 39 . 
     
     
         48 . The method of  claim 41 , wherein the cell is a keratinocyte. 
     
     
         49 . The method of  claim 42 , wherein the cell is a keratinocyte. 
     
     
         50 . The method of  claim 43 , wherein the cell is a keratinocyte. 
     
     
         51 . The method of  claim 44 , wherein the cell is a keratinocyte. 
     
     
         52 . The method of  claim 42 , wherein the subject is a human. 
     
     
         53 . The method of  claim 43 , wherein the subject is a human. 
     
     
         54 . The method of  claim 45 , wherein the subject is a human. 
     
     
         55 . The method of  claim 42 , wherein the nucleic acid molecule is administered topically. 
     
     
         56 . The method of  claim 56 , wherein the nucleic acid is administered dermally. 
     
     
         57 . The method of  claim 44 , wherein the pharmaceutical composition is administered topically. 
     
     
         58 . The method of  claim 57 , wherein the pharmaceutical composition is administered dermally. 
     
     
         59 . The method of  claim 45 , wherein the pharmaceutical composition is administered topically. 
     
     
         60 . The method of  claim 59 , wherein the pharmaceutical composition is administered dermally. 
     
     
         61 . The nucleic acid molecule of  claim 36 , wherein the Hairless Protein mRNA has the sequence as set forth in SEQ ID NO:1.

Cited by (0)

No later patents cite this yet.

References (0)

No backward citations on record.