Nucleic acid sequences for detecting genetic markers for cancer in a biological sample

Abstract

Nucleic acid sequences for detecting the presence of nucleic acids, particularly mRNA, encoding human prostate-associated genetic markers encoding prostate-specific antigen (PSA), prostate specific membrane antigen (PSMA) or human kallikrein 2 (hK2) are disclosed. Preferred combinations of nucleic acid sequences amplifying and detecting the prostate-associated genetic markers RNA, used in methods that include amplification of the target sequences and detection of the amplified sequences are disclosed. Methods of detecting the presence of prostate-associated genetic marker nucleic acids, particularly mRNA, in a biological sample of non-prostate origin are disclosed.

1 . A combination of oligonucleotides used in a detection assay specific for a prostate specific antigen (PSA) target nucleic acid sequence, comprising:
 a first oligonucleotide comprising a target-binding sequence of SEQ ID NO:40 (ACCCAGCAAGATCACGCTTTTG) or its equivalent RNA, or a fully complementary base sequence of the target-binding sequence of SEQ ID NO:40 or its equivalent RNA, that serves as a first amplification primer that hybridizes specifically to a first PSA-specific sequence contained in exon 3 of a PSA expressed gene sequence;   a second oligonucleotide that serves as a second amplification primer that hybridizes specifically to a different, non-overlapping second PSA-specific sequence contained in exon 2 of a PSA expressed gene sequence; and   a third oligonucleotide comprising SEQ ID NO:8 (ACAGCTGCCCACTGCATCAGG) or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:8 or its equivalent RNA, that serves as a detection probe that hybridizes specifically to a third PSA-specific sequence contained in exon 2 of a PSA expressed gene sequence.   
     
     
         2 . The combination of oligonucleotides in  claim 1 , wherein the second oligonucleotide comprises SEQ ID NO:21 (TCTCGTGGCAGGGCAGTCTGC) or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:21 or its equivalent RNA. 
     
     
         3 . The combination of oligonucleotides in  claim 1 , wherein the second oligonucleotide comprises SEQ ID NO:26 (GCAGTCTGCGGCGGTGTTCTG) or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:26 or its equivalent RNA. 
     
     
         4 . A combination of oligonucleotides used in a detection assay specific for a prostate specific antigen (PSA) target nucleic acid sequence, comprising:
 a first oligonucleotide that includes a sequence consisting of a target-binding sequence of SEQ ID NO:40 (ACCCAGCAAGATCACGCTTTTG) or its equivalent RNA, or a fully complementary base sequence of the target-binding sequence of SEQ ID NO:40 or its equivalent RNA, that serves as a first amplification primer that hybridizes specifically to a first PSA-specific sequence contained in exon 3 of a PSA expressed gene sequence;   a second oligonucleotide that serves as a second amplification primer that hybridizes specifically to a different, non-overlapping second PSA-specific sequence contained in exon 2 of a PSA expressed gene sequence; and   a third oligonucleotide consisting of SEQ ID NO:8 (ACAGCTGCCCACTGCATCAGG) or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:8 or its equivalent RNA, that serves as a detection probe that hybridizes specifically to a third PSA-specific sequence contained in exon 2 of a PSA expressed gene sequence.   
     
     
         5 . The combination of oligonucleotides in  claim 4 , wherein the second oligonucleotide consists of SEQ ID NO:21 (TCTCGTGGCAGGGCAGTCTGC) or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:21 or its equivalent RNA. 
     
     
         6 . The combination of oligonucleotides in  claim 4 , wherein the second oligonucleotide consists of SEQ ID NO:26 (GCAGTCTGCGGCGGTGTTCTG) or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:26 or its equivalent RNA. 
     
     
         7 . A method of detecting a prostate-associated target nucleic acid in a biological sample containing nucleic acid, comprising the steps of:
 providing a nucleic acid sample containing a target nucleic acid that includes at least a portion of an expressed gene sequence encoding prostate-specific antigen (PSA);   hybridizing to the target nucleic acid a first oligonucleotide comprising a target-binding sequence of SEQ ID NO:40 (ACCCAGCAAGATCACGCTTTTG) or its equivalent RNA, or a fully complementary base sequence of the target-binding sequence of SEQ ID NO:40 or its equivalent RNA, and an optional promoter sequence adjacent to the target-binding sequence, that serves as a first amplification primer;   hybridizing to the target nucleic acid or a fully complementary strand of the target nucleic acid a second oligonucleotide that serves as a second amplification primer that hybridizes specifically to a different, non-overlapping second PSA-specific sequence contained in exon 2 of a PSA expressed gene sequence;   producing a plurality of amplification products of the target nucleic acid by using the first and second amplification primers and at least one polymerase activity;   providing a probe oligonucleotide comprising SEQ ID NO:8 (ACAGCTGCCCACTGCATCAGG) or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:8 or its equivalent RNA, that hybridizes specifically to at least one amplification product of the target nucleic acid; and   detecting a signal resulting from the probe hybridized to the amplification product.   
     
     
         8 . The method of  claim 7 , wherein the second oligonucleotide comprises SEQ ID NO:21 (TCTCGTGGCAGGGCAGTCTGC) or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:21 or its equivalent RNA. 
     
     
         9 . The method  claim 7 , wherein the second oligonucleotide comprises SEQ ID NO:26 (GCAGTCTGCGGCGGTGTTCTG) or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:26 or its equivalent RNA. 
     
     
         10 . A method of detecting a prostate-associated target nucleic acid in a biological sample containing nucleic acid, comprising the steps of:
 providing a nucleic acid sample containing a target nucleic acid that includes at least a portion of an expressed gene sequence encoding prostate-specific antigen (PSA);   hybridizing to the target nucleic acid a first oligonucleotide that includes a sequence consisting of a target-binding sequence of SEQ ID NO:40 (ACCCAGCAAGATCACGCTTTTG) or its equivalent RNA, or a fully complementary base sequence of the target-binding sequence of SEQ ID NO:40 or its equivalent RNA, and an optional promoter sequence adjacent to the target-binding sequence, that serves as a first amplification primer;   hybridizing to the target nucleic acid or a fully complementary strand of the target nucleic acid a second oligonucleotide that serves as a second amplification primer that hybridizes specifically to a different, non-overlapping second PSA-specific sequence contained in exon 2 of a PSA expressed gene sequence;   producing a plurality of amplification products of the target nucleic acid by using the first and second amplification primers and at least one polymerase activity;   providing a probe oligonucleotide consisting of SEQ ID NO:8 (ACAGCTGCCCACTGCATCAGG) or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:8 or its equivalent RNA, that hybridizes specifically to at least one amplification product of the target nucleic acid; and   detecting a signal resulting from the probe hybridized to the amplification product.   
     
     
         11 . The method of  claim 10 , wherein the second oligonucleotide consists of SEQ ID NO:21 (TCTCGTGGCAGGGCAGTCTGC) or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:21 or its equivalent RNA. 
     
     
         12 . The method of  claim 10  wherein the second oligonucleotide consists of SEQ ID NO:26 (GCAGTCTGCGGCGGTGTTCTG) or its equivalent RNA, or a fully complementary base sequence of SEQ ID NO:26 or its equivalent RNA.