Nucleic acid melting analysis with saturation dyes

Abstract

Methods are provided for nucleic acid analysis wherein a target nucleic acid is mixed with a dsDNA binding dye to form a mixture. Optionally, an unlabeled probe is included in the mixture. A melting curve is generated for the target nucleic acid by measuring fluorescence from the dsDNA binding dye as the mixture is heated. Dyes for use in nucleic acid analysis and methods for making dyes are also provided.

1 - 76 . (canceled) 
     
     
         77 . A PCR reaction mixture comprising
 a. a target nucleic acid,   b. PCR reagents,   c. a pair of oligonucleotide primers configured for amplifying a portion of the target nucleic acid to produce an amplicon, and   d. a dsDNA binding dye having the formula:   
       
         
           
           
               
               
           
         
         wherein 
         the moiety Y represents an optionally-substituted fused monocyclic or polycyclic aromatic ring or an optionally-substituted fused monocyclic or polycyclic nitrogen-containing heteroaromatic ring; 
         X is oxygen, sulfur, selenium, tellurium or a moiety selected from C(CH 3 ) 2  and NR 1 , where R 1  is hydrogen or C 1-6  alkyl; 
         R 2  is selected from the group consisting of C 1-6  alkyl, C 3-8  cycloalkyl, aryl, aryl(C 1-3  alkyl), hydroxyalkyl, alkoxyalkyl, aminoalkyl, mono and dialkylaminoalkyl, trialkylammoniumalkyl, alkylenecarboxylate, alkylenecarboxamide, alkylenesulfonate, optionally substituted cyclic heteroatom-containing moieties, and optionally substituted acyclic heteroatom-containing moieties; 
         t=0 or 1; 
         Z is a charge selected from 0 or 1; 
         R 3 , R 9 , and R 10  are each independently selected from the group consisting of hydrogen, C 1-6  alkyl, and arylcarbonyl; 
         n=0, 1, or 2; and 
         Q is an heterocycle selected from the group of structures consisting of: 
       
       
         
           
           
               
               
           
         
         wherein R 5 , R 6 , R 7 , and R 8  are independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, heteroalkyl, heterocycloalkyl, alkenyl, polyalkenyl, alkynyl, polyalkynyl, alkenylalkynyl, aryl, heteroaryl, alkoxy, alkylthio, arylthio, arylcarbonylthio, dialkylamino, cycloheteroalkylcarbonylthio, dialkylaminoalkylcarbonylthio, cycloalkylthio, cycloheteroalkylthio, trialkylammoniumalkylthio, and nucleosidylthio, each of which may be optionally substituted; an acyclic heteroatom-containing moiety or a cyclic heteroatom-containing moiety, a BRIDGE-DYE, and a reactive group, each of which optionally includes a quaternary ammonium moiety, and 
         R 4  is selected from the group consisting of arylcarbonylthio, cycloheteroalkylcarbonylthio, dialkylaminoalkylcarbonylthio, cycloalkylthio, cycloheteroalkylthio, trialkylammoniumalkylthio, and nucleosidylthio, each of which may be optionally substituted. 
       
     
     
         78 . The PCR reaction mixture of  claim 77  wherein the dsDNA binding dye has a percent saturation of at least 50%. 
     
     
         79 . The PCR reaction mixture of  claim 77  further comprising an unlabeled probe configured to hybridize to at least part of the amplicon. 
     
     
         80 . The PCR reaction mixture of  claim 77 , further comprising a second pair of oligonucleotide primers configured for amplifying a second portion of the target nucleic acid to produce a second amplicon. 
     
     
         81 . A kit for analyzing a target nucleic acid comprising:
 an unlabeled probe, the unlabeled probe blocked at its 3′-end and configured to hybridize substantially complementarily to a portion of the target nucleic acid, and   a dsDNA binding dye having a percent saturation of at least 50%.   
     
     
         82 . The kit of  claim 81 , further comprising
 a thermostable polymerase, and   oligonucleotide primers configured for amplifying the target nucleic acid.   
     
     
         83 . The kit of  claim 82  wherein the oligonucleotide primers comprise a first primer and a second primer, wherein the first primer is provided in a molar amount greater than the second primer. 
     
     
         84 . The kit of  claim 83  wherein the unlabeled probe is configured to hybridize to an amplicon between the first and second primers. 
     
     
         85 . The kit of  claim 81  wherein the unlabeled probe is configured to hybridize completely complementarily to the target nucleic acid. 
     
     
         86 . The kit of  claim 81  wherein the dsDNA binding dye has a percent saturation of at least 90%. 
     
     
         87 . The kit of  claim 81  wherein the dye has the formula: 
       
         
           
           
               
               
           
         
         wherein 
         the moiety Y represents an optionally-substituted fused monocyclic or polycyclic aromatic ring or an optionally-substituted fused monocyclic or polycyclic nitrogen-containing heteroaromatic ring; 
         X is oxygen, sulfur, selenium, tellurium or a moiety selected from C(CH 3 ) 2  and NR 1 , where R 1  is hydrogen or C 1-6  alkyl; 
         R 2  is selected from the group consisting of C 1-6  alkyl, C 3-8  cycloalkyl, aryl, aryl(C 1-3  alkyl), hydroxyalkyl, alkoxyalkyl, aminoalkyl, mono and dialkylaminoalkyl, trialkylammoniumalkyl, alkylenecarboxylate, alkylenecarboxamide, alkylenesulfonate, optionally substituted cyclic heteroatom-containing moieties, and optionally substituted acyclic heteroatom-containing moieties; 
         t=0 or 1; 
         Z is a charge selected from 0 or 1; 
         R 3 , R 9 , and R 10  are each independently selected from the group consisting of hydrogen, C 1-6  alkyl, and arylcarbonyl; 
         n=0, 1, or 2; and 
         Q is an heterocycle selected from the group of structures consisting of: 
       
       
         
           
           
               
               
           
         
         wherein R 5 , R 6 , R 7 , and R 8  are independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, heteroalkyl, heterocycloalkyl, alkenyl, polyalkenyl, alkynyl, polyalkynyl, alkenylalkynyl, aryl, heteroaryl, alkoxy, alkylthio, arylthio, arylcarbonylthio, dialkylamino, cycloheteroalkylcarbonylthio, dialkylaminoalkylcarbonylthio, cycloalkylthio, cycloheteroalkylthio, trialkylammoniumalkylthio, and nucleosidylthio, each of which may be optionally substituted; an acyclic heteroatom-containing moiety or a cyclic heteroatom-containing moiety, a BRIDGE-DYE, and a reactive group, each of which optionally includes a quaternary ammonium moiety, and 
         R 4  is selected from the group consisting of arylcarbonylthio, cycloheteroalkylcarbonylthio, dialkylaminoalkylcarbonylthio, cycloalkylthio, cycloheteroalkylthio, trialkylammoniumalkylthio, and nucleosidylthio, each of which may be optionally substituted. 
       
     
     
         88 . A kit for analyzing a target nucleic acid sequence, the kit comprising:
 i. a pair of primers configured for amplifying the target nucleic acid sequence and in concentration sufficient to reach a crossing point, wherein the target nucleic acid sequence is a locus of a c-kit gene,   ii. a thermostable polymerase, and   iii. a dsDNA binding dye having a percent saturation of at least 50%.   
     
     
         89 . The kit of  claim 88  wherein the analyzing step comprises comparing the shape of the melting curve to the shape of a second melting curve obtained from an analogous wild type amplicon. 
     
     
         90 . The kit of  claim 88  wherein the pair of primers is selected from the group consisting of GATGCTCTGCTTCTGTACTG (SEQ ID NO. 40) and GCCTAAACATCCCCTTAAATTGG (SEQ ID NO. 41); CGGCCATGACTGTCGCTGTAA (SEQ ID NO. 44) and CTCCAATGGTGCAGGCTCCAA (SEQ ID NO. 45); and TCTCCTCCAACCTAATAGTG (SEQ ID NO. 46) and GGACTGTCAAGCAGAGAAT (SEQ ID NO. 47). 
     
     
         91 . The kit of  claim 88  wherein the pair of primers has the nucleotide sequences GATGCTCTGCTTCTGTACTG (SEQ ID NO. 40) and GCCTAAACATCCCCTTAAATTGG (SEQ ID NO. 41), and wherein the amplification mixture further comprises additional primers having the sequences CTCTCCAGAGTGCTCTAATGAC (SEQ ID NO. 42), AGCCCCTGTTTCATACTGACC (SEQ ID NO. 43), CGGCCATGACTGTCGCTGTAA (SEQ ID NO. 44), CTCCAATGGTGCAGGCTCCAA (SEQ ID NO. 45), TCTCCTCCAACCTAATAGTG (SEQ ID NO. 46), GGACTGTCAAGCAGAGAAT (SEQ ID NO. 47). 
     
     
         92 . A kit for analyzing a target nucleic acid comprising:
 an unlabeled probe configured to hybridize substantially complementarily to the target nucleic acid, and   a dsDNA binding dye having the formula:   
       
         
           
           
               
               
           
         
         wherein 
         the moiety Y represents an optionally-substituted fused monocyclic or polycyclic aromatic ring or an optionally-substituted fused monocyclic or polycyclic nitrogen-containing heteroaromatic ring; 
         X is oxygen, sulfur, selenium, tellurium or a moiety selected from C(CH 3 ) 2  and NR 1 , where R 1  is hydrogen or C 1-6  alkyl; 
         R 2  is selected from the group consisting of C 1-6  alkyl, C 3-8  cycloalkyl, aryl, aryl(C 1-3  alkyl), hydroxyalkyl, alkoxyalkyl, aminoalkyl, mono and dialkylaminoalkyl, trialkylammoniumalkyl, alkylenecarboxylate, alkylenecarboxamide, alkylenesulfonate, optionally substituted cyclic heteroatom-containing moieties, and optionally substituted acyclic heteroatom-containing moieties; 
         t=0 or 1; 
         Z is a charge selected from 0 or 1; 
         R 3 , R 9 , and R 10  are each independently selected from the group consisting of hydrogen, C 1-6  alkyl, and arylcarbonyl; 
         n=0, 1, or 2; and 
         Q is an heterocycle selected from the group of structures consisting of: 
       
       
         
           
           
               
               
           
         
         wherein R 5 , R 6 , R 7 , and R 8  are independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, heteroalkyl, heterocycloalkyl, alkenyl, polyalkenyl, alkynyl, polyalkynyl, alkenylalkynyl, aryl, heteroaryl, alkoxy, alkylthio, arylthio, arylcarbonylthio, dialkylamino, cycloheteroalkylcarbonylthio, dialkylaminoalkylcarbonylthio, cycloalkylthio, cycloheteroalkylthio, trialkylammoniumalkylthio, and nucleosidylthio, each of which may be optionally substituted; an acyclic heteroatom-containing moiety or a cyclic heteroatom-containing moiety, a BRIDGE-DYE, and a reactive group, each of which optionally includes a quaternary ammonium moiety, and 
         R 4  is selected from the group consisting of arylcarbonylthio, cycloheteroalkylcarbonylthio, dialkylaminoalkylcarbonylthio, cycloalkylthio, cycloheteroalkylthio, trialkylammoniumalkylthio, and nucleosidylthio, each of which may be optionally substituted. 
       
     
     
         93 . A PCR kit for PCR analysis comprising
 a. PCR reagents, and   b. a dsDNA binding dye having the formula:   
       
         
           
           
               
               
           
         
         wherein 
         the moiety Y represents an optionally-substituted fused monocyclic or polycyclic aromatic ring or an optionally-substituted fused monocyclic or polycyclic nitrogen-containing heteroaromatic ring; 
         X is oxygen, sulfur, selenium, tellurium or a moiety selected from C(CH 3 ) 2  and NR 1 , where R 1  is hydrogen or C 1-6  alkyl; 
         R 2  is selected from the group consisting of C 1-6  alkyl, C 3-8  cycloalkyl, aryl, aryl(C 1-3  alkyl), hydroxyalkyl, alkoxyalkyl, aminoalkyl, mono and dialkylaminoalkyl, trialkylammoniumalkyl, alkylenecarboxylate, alkylenecarboxamide, alkylenesulfonate, optionally substituted cyclic heteroatom-containing moieties, and optionally substituted acyclic heteroatom-containing moieties; 
         t=0 or 1; 
         Z is a charge selected from 0 or 1; 
         R 3 , R 9 , and R 10  are each independently selected from the group consisting of hydrogen, C 1-6  alkyl, and arylcarbonyl; 
         n=0, 1, or 2; and 
         Q is an heterocycle selected from the group of structures consisting of: 
       
       
         
           
           
               
               
           
         
         wherein R 5 , R 6 , R 7 , and R 8  are independently selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, heteroalkyl, heterocycloalkyl, alkenyl, polyalkenyl, alkynyl, polyalkynyl, alkenylalkynyl, aryl, heteroaryl, alkoxy, alkylthio, arylthio, arylcarbonylthio, dialkylamino, cycloheteroalkylcarbonylthio, dialkylaminoalkylcarbonylthio, cycloalkylthio, cycloheteroalkylthio, trialkylammoniumalkylthio, and nucleosidylthio, each of which may be optionally substituted; an acyclic heteroatom-containing moiety or a cyclic heteroatom-containing moiety, a BRIDGE-DYE, and a reactive group, each of which optionally includes a quaternary ammonium moiety, and 
         R 4  is selected from the group consisting of arylcarbonylthio, cycloheteroalkylcarbonylthio, dialkylaminoalkylcarbonylthio, cycloalkylthio, cycloheteroalkylthio, trialkylammoniumalkylthio, and nucleosidylthio, each of which may be optionally substituted. 
       
     
     
         94 . The kit of  claim 93 , wherein the PCR reagents comprise a thermostable polymerase. 
     
     
         95 . The kit of  claim 93 , wherein the dsDNA binding dye is selected from the group consisting of N7, R7, X7, T8, O7, P8, P7, Q7, T7, V7, W8, Z8, Z7, X8, G9, C9, A9, M9, N9, I9, J9, K9, L9, O9, and P9.