Biomarker and composition for diagnosis of preeclampsia

Abstract

The present invention relates to a biomarker and a composition for diagnosis of preeclampsia. In accordance with one aspect of the present invention, there is provided a biomarker for diagnosis of preeclampsia using an enzyme selected from the group consisting of placental chondroitin 4-O-sulfotransferase 1 (C4ST), chondroitin 6-sulfotransferase (C6S), heparan sulfate 6-O-sulfotransferase 1 (HS6S), and dermatan/chondroitin sulfate 2-sulfotransferase (CS-2OST), or uronic acid-2-sulfate (UA2S).

1 . A biomarker for diagnosis of preeclampsia using an enzyme selected from the group consisting of placental chondroitin 4-O-sulfotransferase 1 (C4ST), chondroitin 6-sulfotransferase (C6S), heparan sulfate 6-O-sulfotransferase 1 (HS6S), and dermatan/chondroitin sulfate 2-sulfotransferase (CS-2OST), or uronic acid-2-sulfate (UA2S). 
     
     
         2 . The biomarker of  claim 1 , wherein the biomarker is dermatan/chondroitin sulfate 2-sulfotransferase (CS-2OST) or uronic acid-2-sulfate (UA2S). 
     
     
         3 . The biomarker of  claim 1 , wherein chondroitin 4-O-sulfotransferase 1 (C4ST), chondroitin 6-sulfotransferase (C6S), heparan sulfate 6-O-sulfotransferase 1 (HS6S) and dermatan/chondroitin sulfate 2-sulfotransferase (CS-2OST) have NCBI GenBank Accession Numbers of NM — 018413, NM — 004273, NM — 004807 and NM — 005715, respectively. 
     
     
         4 . A composition for diagnosis of preeclampsia, comprising one or more primer pairs selected from the group consisting of primer pairs with the sequences of:
 (Primer Pair No. 1) Forward: 5′GTGGGGAGAGGGAGAGAATC3′ (Sequence No. 1), Reverse: 5′ACAGACAAGAACGACCCATC3′ (Sequence No. 2);   (Primer Pair No. 2) Forward: 5′CCCAAAGTCAGAAAGCGAAG3′ (Sequence No. 3), Reverse: 5′ACAAGCAAACCCACCAACTC3′ (Sequence No. 4);   (Primer Pair No. 3) Forward: 5′TCTGAGCCTGACCACAGATG3′ (Sequence No. 5), Reverse: 5′CACCTGCACAGAACTCAGGA3′ (Sequence No. 6);   (Primer Pair No. 4) Forward: 5′CCCAGTGGCCCTAAAGTACA3′ (Sequence No. 7), Reverse: 5′GTCCATCACTTTGGCAGGTT3′ (Sequence No. 8); and   (Primer Pair No. 5) Forward: 5′GTACAACCTGGCCAACAACC3′ (Sequence No. 9), Reverse: 5″CGCGTGCTATTGTACTGCAT3′ (Sequence No. 10).