Induction of exon skipping in eukaryotic cells

Abstract

The present invention provides a method for at least in part decreasing the production of an aberrant protein in a cell, the cell comprising pre-mRNA comprising exons coding for the protein, by inducing so-called exon skipping in the cell. Exon-skipping results in mature mRNA that does not contain the skipped exon, which leads to an altered product of the exon codes for amino acids. Exon skipping is performed by providing a cell with an agent capable of specifically inhibiting an exon inclusion signal, for instance, an exon recognition sequence, of the exon. The exon inclusion signal can be interfered with by a nucleic acid comprising complementarity to a part of the exon. The nucleic acid, which is also herewith provided, can be used for the preparation of a medicament, for instance, for the treatment of an inherited disease.

1 - 24 . (canceled) 
     
     
         25 . A method for directing splicing of a dystrophin pre-mRNA in a cell having dystrophin pre-mRNA, the method comprising:
 contacting the dystrophin pre-mRNA in the cell with an antisense-oligonucleotide having between 14-40 nucleotides, capable of specifically inhibiting an exon inclusion signal of exon number 2, 8, 29, 43, 44, 45; 46, 50, 51, 52, or 53 in the pre-mRNA, and   allowing splicing of the pre-mRNA.   
     
     
         26 . The method according to  claim 25 , wherein the cell is a cell from an individual suffering from Duchenne Muscular Dystrophy (DMD). 
     
     
         27 . The method according to  claim 26 , wherein the dystrophin pre-mRNA comprises a DMD deletion of one or more exons selected from the groups consisting of exons 3-7, 4-7, 5-7, 6-7, 18-44, 35-43, 44, 44-47, 45, 45-54, 45-52, 50, 50-52, 45-50, 46-47, 46-48, 46 49, 46-51, 46-53, 48-52, 48-50, 49-50, 49-52, 52, 52-63, 51, 51-55, 53, and 53-55. 
     
     
         28 . The method according to  claim 25 , wherein the antisense-oligonucleotide exhibiting the specific inhibition of an exon inclusion signal is obtainable by a method comprising:
 providing a second cell with the antisense-oligonucleotide, the cell having pre-mRNA containing the exon,   culturing the second cell to form mRNA in the second cell from the pre-mRNA in the second cell, and   determining whether the exon is absent from the thus formed mRNA in the second cell.   
     
     
         29 . The method according to  claim 25 , further comprising allowing translation of an mRNA produced from splicing of the dystrophin pre-mRNA. 
     
     
         30 . The method according to  claim 29 , wherein the mRNA encodes a functional dystrophin protein. 
     
     
         31 . The method according to  claim 30 , wherein the functional dystrophin protein comprises at least two domains, wherein at least one of the domains is encoded by the mRNA as a result of skipping of at least part of an exon in the dystrophin pre-mRNA. 
     
     
         32 . The method according to  claim 25 , wherein contacting results in activation of a cryptic splice site in a contacted exon. 
     
     
         33 . The method according to  claim 25 , wherein the exon inclusion signal is present in an exon comprising a strong splice donor/acceptor pair. 
     
     
         34 . The method according to  claim 29 , wherein the translation results in a mutant dystrophin protein or a normal dystrophin protein. 
     
     
         35 . The method according to  claim 34 , wherein the mutant dystrophin protein is equivalent to a dystrophin protein of a Becker patient. 
     
     
         36 . The method according to  claim 25 , wherein the antisense-oligonucleotide is capable of specifically inhibiting an exon inclusion signal of exon number 51. 
     
     
         37 . The method according to  claim 25 , wherein the antisense-oligonucleotide comprises a nucleic acid. 
     
     
         38 . The method according to  claim 37 , wherein the nucleic acid comprises a 2′-O-methyl-oligoribonucleotide or a 2′-O-methyl-phosphorothioate. 
     
     
         39 . The method according to  claim 25 , wherein the antisense-oligonucleotide contains between 15-25 nucleotides. 
     
     
         40 . The method according to  claim 25 , further comprising:
 providing the cell with another antisense-oligonucleotide capable of inhibiting an exon inclusion signal present in another exon of the dystrophin pre-mRNA.   
     
     
         41 . A method for at least in part decreasing the production of an aberrant dystrophin protein in a cell, the cell comprising dystrophin pre-mRNA comprising exons coding for the aberrant dystrophin protein, the method comprising:
 providing the cell with an antisense-oligonucleotide having between 14-40 nucleotides, capable of specifically inhibiting an exon inclusion signal of exon number 2, 8, 29, 43, 44, 45, 46, 50, 51, 52, or 53, and   allowing translation of mRNA produced from splicing of the dystrophin pre-mRNA.   
     
     
         42 . The method according to  claim 41 , wherein the antisense-oligonucleotide exhibiting the specific inhibition of an exon inclusion signal is obtainable by a method comprising:
 providing a second cell with the antisense-oligonucleotide, the cell having pre-mRNA containing the exon,   culturing the second cell to form mRNA in the second cell from the pre-mRNA in the second cell, and   determining whether the exon is absent from the thus formed mRNA in the second cell.   
     
     
         43 . The method according to  claim 41 , wherein the antisense-oligonucleotide is capable of specifically inhibiting an exon inclusion signal of exon number 51. 
     
     
         44 . The method according to  claim 41 , wherein the dystrophin pre-mRNA comprises a Duchenne Muscular Dystrophy (DMD) deletion of one or more exons selected from the groups consisting of exons 3-7, 4-7, 5-7, 6-7, 18-44, 35-43, 44, 44-47, 45, 45-54, 45-52, 50, 50-52, 45-50, 46-47, 46-48, 46-49, 46-51, 46-53, 48-52, 48-50, 49-50, 49-52, 52, 52-63, 51, 51 55, 53, and 53-55. 
     
     
         45 . The method according to  claim 41 , wherein the antisense-oligonucleotide comprises a nucleic acid. 
     
     
         46 . The method according to claim  21 , wherein the nucleic acid comprises a 2′-O-methyl-oligoribonucleotide or a 2′-O-methyl-phosphorothioate oligoribonucleotide. 
     
     
         47 . The method according to  claim 45 , wherein the antisense-oligonucleotide contains between 15-25 nucleotides. 
     
     
         48 . The method according to  claim 41 , further comprising:
 providing the cell with another antisense-oligonucleotide capable of inhibiting an exon inclusion signal present in another exon of the dystrophin pre-mRNA.   
     
     
         49 . A method for determining whether a compound is able specifically inhibit an exon inclusion signal of an exon of a dystrophin pre-mRNA, the exon being selected from the group consisting of exon number 2, 8, 29, 43, 44, 45, 46, 50, 51, 52, or 53 and combinations thereof of the dystrophin pre-mRNA, wherein the compound has complementarity to a part of the selected exon, the method comprising:
 providing a cell having a dystrophin pre-mRNA containing the exon with the compound,   culturing the cell to allow the formation of an mRNA from the dystrophin pre-mRNA, and   determining whether the exon is absent from the mRNA.   
     
     
         50 . The method according to  claim 49  further comprising determining in vitro the relative binding affinity of the compound to an RNA molecule comprising the exon. 
     
     
         51 . A compound identified by the method according to  claim 49 . 
     
     
         52 . A nucleic acid delivery vehicle comprising the compound of  claim 51 , or the complement thereof. 
     
     
         53 . A nucleic acid delivery vehicle comprising the compound of  claim 51 . 
     
     
         54 . A method for directing splicing of a dystrophin pre-mRNA in a subject, the method comprising:
 administering to the subject the compound of  claim 51 .   
     
     
         55 . A method for directing splicing of a dystrophin pre-mRNA in a subject, the method comprising administering to the subject the nucleic acid delivery vehicle of  claim 52 . 
     
     
         56 . A method for directing splicing of a dystrophin pre-mRNA in a subject, the method comprising:
 administering to the subject an antisense-oligonucleotide, having between 14-40 nucleotides, and having complementarity to an element located within an exon in the pre-mRNA, the exon being selected from the group consisting of exon number 2, 8, 29, 43, 44, 45, 46, 50, 51, 52, or 53 and combinations thereof of a dystrophin gene encoding an aberrant protein,   wherein the antisense-oligonucleotide specifically inhibits and interferes with an exon inclusion signal of the exon in the pre-mRNA, thus forming a final mRNA excluding the exon, but encoding a mutant dystrophin protein having Becker mutant's functionality.   
     
     
         57 . The method according to  claim 56 , wherein the antisense-oligonucleotide that specifically inhibits and interferes with an exon inclusion signal of the exon in the pre-mRNA is obtainable by a method comprising:
 providing a cell with the antisense-oligonucleotide, the cell having a pre-mRNA containing the exon, culturing the cell to form mRNA in the cell from the pre-mRNA in the cell, and determining whether the exon is absent from the thus formed mRNA in the cell.   
     
     
         58 . The method according to  claim 56 , wherein the antisense-oligonucleotide contains between 15-25 nucleotides. 
     
     
         59 . A non-human animal provided with the compound of  claim 51 . 
     
     
         60 . The non-human animal of  claim 59 , further comprising a nucleic acid encoding a human protein. 
     
     
         61 . The non-human animal of  claim 60 , further comprising a silencing mutation in a gene encoding an animal homologue of the human protein. 
     
     
         62 . A composition comprising:
 a nucleic acid or a functional equivalent thereof capable of inhibiting an exon inclusion signal in exon 2, 8, 29, 43, 44, 45, 46, 50, 51 or 53 of a dystrophin pre-mRNA, and having between 14-40 nucleotides.   
     
     
         63 . The composition of  claim 62 , further comprising:
 a further nucleic acid or a functional equivalent thereof capable of inhibiting an exon inclusion signal present in another exon of the dystrophin pre-mRNA.   
     
     
         64 . The composition of  claim 62 , wherein the nucleic acid is an antisense-oligonucleotide containing between 15-25 nucleotides. 
     
     
         65 . A nucleic acid delivery vehicle comprising:
 an antisense-oligonucleotide capable of inhibiting an exon-inclusion signal in at least one of exons 2, 8, 29, 43, 44, 45, 50, 51, 52 or 53 of a dystrophin pre-mRNA, wherein the antisense-oligonucleotide contains between 14-40 nucleotides, or   the complement of said antisense-oligonucleotide.   
     
     
         66 . The nucleic acid delivery vehicle of  claim 65 , wherein the antisense-oligonucleotide contains between 15-25 nucleotides. 
     
     
         67 . An antisense-oligonucleotide comprising one a nucleic acid sequence selected from the group consisting of 
       
         
           
                 
                 
                 
                 
               
                     
                   hAON#4: 
                     
                     
                 
                     
                   5′ CTGCTTCCTCCAACC, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#6: 
                 
                     
                   5′ GTTATCTGCTTCCTCCAACC, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#8: 
                 
                     
                   5′ GCTTTTCTTTTAGTTGCTGC, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#9: 
                 
                     
                   5′ TTAGTTGCTGCTCTT, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#11: 
                 
                     
                   5′ TTGCTGCTCTTTTCC, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#21: 
                 
                     
                   5′ CCACAGGTTGTGTCACCAG, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#22: 
                 
                     
                   5′ TTTCCTTAGTAACCACAGGTT, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#23: 
                 
                     
                   5′ TGGCATTTCTAGTTTGG, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#24: 
                 
                     
                   5′ CCAGAGCAGGTACCTCCAACATC, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#25: 
                 
                     
                   5′ GGTAAGTTCTGTCCAAGCCC, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#26: 
                 
                     
                   5′ TCACCCTCTGTGATTTTAT, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#27: 
                 
                     
                   5′ CCCTCTGTGATTTT, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#28: 
                 
                     
                   5′ TCACCCACCATCACCCT, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#29: 
                 
                     
                   5′ TGATATCCTCAAGGTCACCC, 
                   (SEQ ID NO: _) 
                 
                     
                     
                 
                     
                   hAON#30: 
                 
                     
                   5′ CTGCTTGATGATCATCTCGTT, 
                   (SEQ ID NO: _) 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
       a functional part of any thereof, derivative of any thereof, and analogue of any thereof having the same exon skipping activity in kind, but not necessarily in amount. 
     
     
         68 . The antisense-oligonucleotide of  claim 67 , containing between 14-40 nucleotides. 
     
     
         69 . A nucleic acid delivery vehicle capable of expressing the antisense-oligonucleotide of  claim 67 . 
     
     
         70 . The nucleic acid delivery vehicle of  claim 69 , wherein the nucleic acid delivery vehicle is a single stranded virus. 
     
     
         71 . The nucleic acid delivery vehicle of  claim 70 , wherein said single stranded virus comprises an adeno-associated virus. 
     
     
         72 . A method for directing splicing of a dystrophin pre-mRNA in a subject, the method comprising administering to the subject the nucleic acid delivery vehicle of  claim 53 .