Packaging of Immunostimulatory Substances Into Virus-Like Particles: Method of Preparation and Use

Abstract

The invention relates to the finding that virus like particles (VLPs) can be loaded with immunostimulatory substances, in particular with DNA oligonucleotides containing non-methylated C and G (CpGs). Such CpG-VLPs are dramatically more immunogenic than their CpG-free counterparts and induce enhanced B and T cell responses. The immune response against antigens optionally coupled, fused or attached otherwise to the VLPs is similarly enhanced as the immune response against the VLP itself. In addition, the T cell responses against both the VLPs and antigens are especially directed to the Th1 type. Antigens attached to CpG-loaded VLPs may therefore be ideal vaccines for prophylactic or therapeutic vaccination against allergies, tumors and other self-molecules and chronic viral diseases.

1 - 68 . (canceled) 
     
     
         69 . A method of producing a composition for enhancing an immune response in an animal, said composition comprising a virus-like particle and an immunostimulatory substance packaged into said virus-like particle, wherein said method comprises:
 (a) disassembling said virus-like particle;   (b) adding said immunostimulatory substance; and   (c) reassembling said virus-like particle;   
       wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence, and wherein said palindromic sequence is flanked at its 3′-terminus and at its 5′-terminus by less than 10 guanosine entities. 
     
     
         70 . The method of  claim 69 , wherein said unmethylated CpG-containing oligonucleotide consists of 10 to 30 nucleotides, and wherein said palindromic sequence is GACGATCGTC (SEQ ID NO:1), and wherein said palindromic sequence is flanked at its 5′-terminus by at least 3 and at most 9 guanosine entities and wherein said palindromic sequence is flanked at its 3′-terminus by at least 6 and at most 9 guanosine entities. 
     
     
         71 - 72 . (canceled) 
     
     
         73 . The method of  claim 70 , wherein said unmethylated CpG-containing oligonucleotide consists of a nucleic acid sequence selected from the group consisting of: 
       
         
           
                 
                 
               
                   (a) GGGGACGATCGTCGGGGGG; 
                   (SEQ ID NO: 2) 
                 
                     
                 
                   (b) GGGGGACGATCGTCGGGGGG; 
                   (SEQ ID NO: 3) 
                 
                     
                 
                   (c) GGGGGGACGATCGTCGGGGGG; 
                   (SEQ ID NO: 4) 
                 
                     
                 
                   (d) GGGGGGGACGATCGTCGGGGGG; 
                   (SEQ ID NO: 5) 
                 
                     
                 
                   (e) GGGGGGGGACGATCGTCGGGGGGG; 
                   (SEQ ID NO: 6) 
                 
                     
                 
                   (f) GGGGGGGGGACGATCGTCGGGGGGGG; 
                   (SEQ ID NO: 7) 
                 
                     
                 
                   (g) GGGGGGGGGGACGATCGTCGGGGGGGGG; 
                   (SEQ ID NO: 8) 
                 
                   and 
                 
                     
                 
                   (h) GGGGGGCGACGACGATCGTCGTCGGGGGGG. 
                   (SEQ ID NO: 9) 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         74 . The method of  claim 69 , wherein said unmethylated CpG-containing oligonucleotide consists of 10 to 30 nucleotides, wherein said palindromic sequence is GACGATCGTC (SEQ ID NO:1), and wherein said palindromic sequence is flanked at its 5′-terminus by at least 4 and at most 9 guanosine entities and wherein said palindromic sequence is flanked at its 3′-terminus by at least 6 and at most 9 guanosine entities. 
     
     
         75 - 79 . (canceled) 
     
     
         80 . The method of  claim 69  further comprising removing nucleic acids of said disassembled virus-like particle. 
     
     
         81 . The method of  claim 69  further comprising purifying said composition after reassembly. 
     
     
         82 . The method of  claim 69 , further comprising binding an antigen or antigenic determinant to said virus-like particle. 
     
     
         83 . (canceled) 
     
     
         84 . The method of  claim 82 , wherein said antigen or antigenic determinant is bound to said virus-like particle after reassembling said virus-like particle. 
     
     
         85 - 113 . (canceled) 
     
     
         114 . The method of  claim 69 , wherein said virus-like particle is a virus-like particle of an RNA-phage. 
     
     
         115 . The method of  claim 114 , wherein said RNA-phage is bacteriophage Qβ. 
     
     
         116 . The method of  claim 115 , wherein said virus-like particle comprises or consists of recombinant proteins of RNA-bacteriophage Qβ, wherein said recombinant proteins consist of the amino acid sequence of SEQ ID NO:10. 
     
     
         117 . The method of  claim 116 , wherein said unmethylated CpG-containing oligonucleotide consists of a nucleic acid sequence selected from the group consisting of: 
       
         
           
                 
                 
               
                   (a) GGGGGGACGATCGTCGGGGGG; 
                   (SEQ ID NO: 4) 
                 
                     
                 
                   (b) GGGGGGGACGATCGTCGGGGGG; 
                   (SEQ ID NO: 5) 
                 
                     
                 
                   (c) GGGGGGGGACGATCGTCGGGGGGG; 
                   (SEQ ID NO: 6) 
                 
                   and 
                 
                     
                 
                   (d) GGGGGGGGGACGATCGTCGGGGGGGG. 
                   (SEQ ID NO: 7) 
                 
             
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         118 . The method of  claim 115 , further comprising binding an antigen or antigenic determinant to said virus-like particle by way of a covalent bond. 
     
     
         119 . The method of  claim 118 , wherein said virus-like particle comprises at least one first attachment site and wherein said antigen or antigenic determinant further comprises at least one second attachment site selected from the group consisting of:
 (a) an attachment site not naturally occurring with said antigen or antigenic determinant; and   (b) an attachment site naturally occurring with said antigen or antigenic determinant;   
       wherein said binding of said antigen or antigenic determinant to said virus-like particle is effected through association between said first attachment site and said second attachment site, wherein said association is through at least one non-peptide covalent bond, and wherein said antigen or antigenic determinant and said virus-like particle interact through said association to form an ordered and repetitive antigen array. 
     
     
         120 . The method of  claim 119 , wherein said first attachment site is a lysine residue and said second attachment site is a cysteine residue. 
     
     
         121 . The method of  claim 120 , wherein said binding is effected by a hetero-bifunctional crosslinker. 
     
     
         122 . The method of  claim 121 , wherein said virus-like particle comprises or consists of recombinant proteins of RNA-bacteriophage Qβ, wherein said recombinant proteins consist of the amino acid sequence of SEQ ID NO:10. 
     
     
         123 . The method of  claim 122 , wherein said unmethylated CpG-containing oligonucleotide consists of 10 to 30 nucleotides, wherein said palindromic sequence is GACGATCGTC (SEQ ID NO:1), wherein said palindromic sequence is flanked at its 5′-terminus by at least 3 and at most 9 guanosine entities and wherein said palindromic sequence is flanked at its 3′-terminus by at least 6 and at most 9 guanosine entities. 
     
     
         124 . The method of  claim 123 , wherein said unmethylated CpG-containing oligonucleotide consists of a nucleic acid sequence selected from the group consisting of 
       
         
           
                 
                 
               
                   (a) GGGGGGACGATCGTCGGGGGG; 
                   (SEQ ID NO: 4) 
                 
                     
                 
                   (b) GGGGGGGACGATCGTCGGGGGG; 
                   (SEQ ID NO: 5) 
                 
                     
                 
                   (c) GGGGGGGGACGATCGTCGGGGGGG; 
                   (SEQ ID NO: 6) 
                 
                   and 
                 
                     
                 
                   (d) GGGGGGGGGACGATCGTCGGGGGGGG. 
                   (SEQ ID NO: 7) 
                 
             
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         125 . The method of  claim 124 , wherein said hetero-bifunctional cross-linker is succinimidyl-6-(β-maleimidopropionamido)hexanoate (SMPH).