Melan-a-carrier conjugates

Abstract

The present invention is related to the fields of molecular biology, virology, immunology and medicine. The invention provides a modified virus-like particle (VLP) comprising a VLP which can be loaded with immunostimulatory substances, in particular with DNA oligonucleotides containing non-methylated C and G (CpGs), and particular peptides derived from MelanA linked thereto. Such CpG-VLPs are dramatically more immunogenic than their CpG-free counterparts and induce enhanced B and T cell responses. The immune response against MelanA peptide analogues optionally coupled, fused or attached otherwise to the VLPs is similarly enhanced as the immune response against the VLP itself. In addition, the T cell responses against the MelanA peptide analogues are especially directed to the Th1 type. Antigens attached to CpG-loaded VLPs may therefore be ideal vaccines for prophylactic or therapeutic vaccination against allergies, tumors and other self-molecules and chronic viral diseases.

1 . A composition comprising:
 (a) a virus-like particle;   (b) at least one immunostimulatory substance,
 (i) wherein said immunostimulatory substance is an immunostimulatory nucleid acid; and 
 (ii) wherein said immunostimulatory substance is packaged into said virus-like particle; and 
   (c) at least one antigen or antigenic determinant;   
       wherein said antigen or antigenic determinant is bound to said virus-like particle, and wherein said antigen comprises, or consists of a human melanoma MelanA peptide analogue. 
     
     
         2 . The composition of  claim 1 , wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one non-peptide covalent bond. 
     
     
         3 . (canceled) 
     
     
         4 . (canceled) 
     
     
         5 . The composition of  claim 1 , wherein said human melanoma MelanA peptide analogue is characterized by two or by a single amino acid substitution with respect to the corresponding normal MelanA peptide. 
     
     
         6 . (canceled) 
     
     
         7 . The composition of  claim 1 , wherein said human melanoma MelanA peptide analogue has an amino acid sequence selected from the group consisting of: 
       
         
           
                 
                 
                 
               
                     
                   (a) LAGIGILTV; 
                   (SEQ ID NO: 84) 
                 
                     
                     
                 
                     
                   (b) MAGIGILTV; 
                   (SEQ ID NO: 85) 
                 
                     
                     
                 
                     
                   (c) EAMGIGILTV; 
                   (SEQ ID NO: 86) 
                 
                     
                     
                 
                     
                   (d) ELAGIGILTV; 
                   (SEQ ID NO: 50) 
                 
                     
                     
                 
                     
                   (e) EMAGIGILTV; 
                   (SEQ ID NO: 87) 
                 
                     
                     
                 
                     
                   (f) YAAGIGILTV; 
                   (SEQ ID NO: 88) 
                 
                     
                   and 
                     
                 
                     
                     
                 
                     
                   (g) FAAGIGILTV. 
                   (SEQ ID NO: 89) 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         8 . The composition of  claim 1 , wherein said human melanoma MelanA/MART-1 peptide analogue comprises or consists of the sequence ELAGIGILTV (SEQ ID NO:50). 
     
     
         9 . The composition of  claim 1 , wherein said virus-like particle comprises at least one first attachment site and wherein said antigen or antigenic determinant further comprises at least one second attachment site being selected from the group consisting of:
 (a) an attachment site not naturally occurring with said antigen or antigenic determinant; and   (b) an attachment site naturally occurring with said antigen or antigenic determinant;   
       and wherein said binding of said antigen or antigenic determinant to said virus-like particle is effected through association between said first attachment site and said second attachment site, wherein said association is through at least one non-peptide bond. 
     
     
         10 . The composition of  claim 9 , wherein said antigen or antigenic determinant and said virus-like particle interact through said association to form an ordered and repetitive antigen array. 
     
     
         11 . (canceled) 
     
     
         12 . (canceled) 
     
     
         13 . The composition of  claim 9 , wherein said first attachment site is a lysine residue and said second attachment site is a cysteine residue. 
     
     
         14 . (canceled) 
     
     
         15 . The composition of  claim 9 , wherein said human melanoma MelanA/MART-1 peptide analogue with said second attachment site has an amino acid sequence selected from the group consisting of: 
       
         
           
                 
                 
                 
               
                     
                   (a)SYTTAEELAGIGILTV; 
                   (SEQ ID NO: 55) 
                 
                     
                     
                 
                     
                   (a)CGGELAGIGILTV; 
                   (SEQ ID NO: 57) 
                 
                     
                     
                 
                     
                   (a)CSYTTAEELAGIGILTV ILGVL; 
                   (SEQ ID NO: 58) 
                 
                     
                     
                 
                     
                   (a)CGGELAGIGILTVILGVL; 
                   (SEQ ID NO: 59) 
                 
                     
                     
                 
                     
                   (a)ELAGIGILTVGGC;  
                   (SEQ ID NO: 60) 
                 
                     
                     
                 
                     
                   (a)CSPKSLELAGIGILTV;  
                   (SEQ ID NO: 92) 
                 
                     
                   and 
                     
                 
                     
                     
                 
                     
                   (a)ELAGIGILTVILGVLGGC.  
                   (SEQ ID NO: 93) 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         16 . The composition of  claim 9 , wherein said human melanoma MelanA/MART-1 peptide analogue with said second attachment site has an amino acid sequence of CGHGHSYTTAEELAGIGILTV (SEQ ID NO:55). 
     
     
         17 . (canceled) 
     
     
         18 . The composition of  claim 1 , wherein said virus-like particle is a recombinant virus-like particle, wherein preferably said virus like particle is selected from the group consisting of:
 (a) recombinant proteins of Hepatitis B virus;   (b) recombinant proteins of measles virus;   (c) recombinant proteins of Sindbis virus;   (d) recombinant proteins of Rotavirus;   (e) recombinant proteins of Foot-and-Mouth-Disease virus;   (f) recombinant proteins of Retrovirus;   (g) recombinant proteins of Norwalk virus;   (h) recombinant proteins of human Papilloma virus;   (i) recombinant proteins of BK virus;   (j) recombinant proteins of bacteriophages;   (k) recombinant proteins of RNA-phages;   (l) recombinant proteins of Ty; and   (m) fragments of any of the recombinant proteins from (a) to (l).   
     
     
         19 . (canceled) 
     
     
         20 . (canceled) 
     
     
         21 . The composition of  claim 1 , wherein said virus-like particle comprises or consists of recombinant proteins, or fragments thereof, of a RNA-phage, wherein said RNA-phage is selected from the group consisting of:
 (a) bacteriophage Qβ;   (b) bacteriophage R17;   (c) bacteriophage fr;   (d) bacteriophage GA;   (e) bacteriophage SP;   (f) bacteriophage MS2;   (g) bacteriophage M11;   (h) bacteriophage MX1;   (i) bacteriophage NL95;   (j) bacteriophage f2;   (k) bacteriophage PP7; and   (l) bacteriophage AP205.   
     
     
         22 . The composition of  claim 1 , wherein said virus-like particle comprises or consists of recombinant proteins, or fragments thereof, of bacteriophage Qβ or bacteriophage AP205. 
     
     
         23 . (canceled) 
     
     
         24 . (canceled) 
     
     
         25 . (canceled) 
     
     
         26 . (canceled) 
     
     
         27 . The composition of  claim 1 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide. 
     
     
         28 . (canceled) 
     
     
         29 . (canceled) 
     
     
         30 . The composition of  claim 1 , wherein said unmethylated CpG-containing oligonucleotide comprises or consists of a palindromic sequence, wherein said palindromic sequence comprises or consists of GACGATCGTC (SEQ ID NO:1). 
     
     
         31 . The composition of  claim 27 , wherein said unmethylated CpG-containing oligonucleotide comprises or consists of the sequence selected from the group consisting of: 
       
         
           
                 
                 
               
                   (a) TCCATGACGTTCCTGAATAAT; 
                   (SEQ ID NO: 35) 
                 
                     
                 
                   (b) TCCATGACGTTCCTGACGTT; 
                   (SEQ ID NO: 37) 
                 
                     
                 
                   (c) GGGGTCAACGTTGAGGGGG; 
                   (SEQ ID NO: 39) 
                 
                     
                 
                   (d) GGGGGGGGGGGACGATCGTCGGGGGGGGGG; 
                   (SEQ ID NO: 41) 
                 
                   and 
                     
                 
                     
                 
                   (e) “dsCyCpG-253”. 
                   (SEQ ID NO: 49) 
                 
             
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         32 . The composition of  claim 27 , wherein said unmethylated CpG-containing oligonucleotide comprises or consists of the sequence GGGGGGGGGG GACGATCGTC GGGGGGGGGG (SEQ ID NO:41). 
     
     
         33 .- 38 . (canceled) 
     
     
         39 . The composition of  claim 30 , wherein said palindromic sequence is flanked at its 5′-terminus by at least 3 and at most 10 guanosine entities and wherein said palindromic sequence is flanked at its 3′-terminus by at least 6 and at most 10 guanosine entities. 
     
     
         40 .- 45 . (canceled) 
     
     
         46 . A method for enhancing an immune response in an animal comprising introducing into said animal a composition comprising:
 (a) a virus-like particle;   (b) at least one immunostimulatory substance,
 (i) wherein said immunostimulatory substance is an immunostimulatory oligonucleotide; and 
 (ii) wherein said immunostimulatory substance is packaged into said virus-like particle; and 
   (c) at least one antigen or antigenic determinant;   
       wherein said antigen or antigenic determinant is bound to said virus-like particle, and wherein said antigen comprises or consists of a human melanoma MelanA peptide analogue. 
     
     
         47 .- 91 . (canceled) 
     
     
         92 . A vaccine comprising an immunologically effective amount of the composition of  claim 1  together with a pharmaceutically acceptable diluent, carrier or excipient. 
     
     
         93 .- 98 . (canceled)