dsRNA COMPOSITIONS AND METHODS FOR TREATING HPV INFECTION

Abstract

The invention relates to a double-stranded ribonucleic acid (dsRNA) for treating human papilloma virus (HPV) infection. The dsRNA comprises an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of an HPV Target gene selected from among HPV E1, HPV E6 and the human E6AP gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by HPV infection and the expression of the E6AP gene using the pharmaceutical composition; and methods for inhibiting the expression of the HPV Target genes in a cell.

1 . A double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a human E6AP gene in a cell, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity which is complementary to an mRNA encoding the E6AP gene, and wherein said region of complementarity is less than 30 nucleotides in length and wherein said dsRNA, upon contact with a cell expressing said E6AP gene, inhibits expression of said E6AP gene by at least 40%. 
     
     
         2 . A double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a human E6AP gene in a cell, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to at least 15 contiguous nucleotides of SEQ ID NO:1752 (nucleotides 766-832 of MN — 130838, “CACCUAACGUGGAAUGUGACUUGACGUAUCACAAUGUAUACUCUCGAGAU CCUAAUUAUCUGAAUUU”), and wherein said region of complementarity is less than 30 nucleotides in length and wherein said dsRNA, upon contact with a cell expressing said E6AP, inhibits expression of said E6AP gene by at least 40% as compared to a control cell. 
     
     
         3 . The dsRNA of  claim 2 , wherein the antisense strand comprises a sequence selected from the group consisting of: SEQ ID NO: 334, SEQ ID NO: 336, SEQ ID NO: 319, SEQ ID NO: 317, SEQ ID NO: 330, and SEQ ID NO: 322. 
     
     
         4 . The dsRNA of  claim 2 , wherein the antisense strand consists of a sequence selected from the group consisting of: SEQ ID NO: 334, SEQ ID NO: 336, SEQ ID NO: 319, SEQ ID NO: 317, SEQ ID NO: 330, and SEQ ID NO: 322. 
     
     
         5 . The dsRNA of  claim 2 , wherein the sense strand comprises SEQ ID NO: 178 and the antisense strand comprises SEQ ID NO: 334 or the sense strand comprises SEQ ID NO: 180 and the antisense strand comprises SEQ ID NO: 336 or the sense strand comprises SEQ ID NO: 163 and the antisense strand comprises SEQ ID NO: 319 or the sense strand comprises SEQ ID NO: 161 and the antisense strand comprises SEQ ID NO: 317 or the sense strand comprises SEQ ID NO: 174 and the antisense strand comprises SEQ ID NO: 330 or the sense strand comprises SEQ ID NO: 166 and the antisense strand comprises SEQ ID NO: 322. 
     
     
         6 . The dsRNA of  claim 2 , wherein the sense strand consists of SEQ ID NO:178 and the antisense strand consists of SEQ ID NO:334 or the sense strand consists of SEQ ID NO: 180 and the antisense strand consists of SEQ ID NO: 336 or the sense strand consists of SEQ ID NO: 163 and the antisense strand consists of SEQ ID NO: 319 or the sense strand consists of SEQ ID NO: 161 and the antisense strand consists of SEQ ID NO: 317 or the sense strand consists of SEQ ID NO: 174 and the antisense strand consists of SEQ ID NO: 330 or the sense strand consists of SEQ ID NO: 166 and the antisense strand consists of SEQ ID NO: 322. 
     
     
         7 . The dsRNA of  claim 2 , wherein said contact is performed in vitro at 30 nM or less. 
     
     
         8 . The dsRNA of  claim 2 , wherein at least one nucleotide of at least one strand is a modified nucleotide. 
     
     
         9 . The dsRNA of  claim 3 , wherein at least one nucleotide of at least one strand is a modified nucleotide. 
     
     
         10 . The dsRNA of  claim 9 , wherein said modified nucleotide is chosen from the group of: a 2′-O-methyl modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group. 
     
     
         11 . The dsRNA of  claim 9 , wherein said modified nucleotide is a 2′-O-methyl modified nucleotide. 
     
     
         12 . The dsRNA of  claim 9 , wherein said modified nucleotide is a nucleotide comprising a 5′-phosphorothioate group. 
     
     
         13 . The dsRNA of  claim 9 , wherein said modified nucleotide is chosen from the group of: a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. 
     
     
         14 . A pharmaceutical composition for inhibiting the expression of the E6AP gene in an organism, comprising the dsRNA of  claim 2  and a pharmaceutically acceptable carrier. 
     
     
         15 . The pharmaceutical composition of  claim 14 , wherein the sense strand comprises SEQ ID NO:178 and the antisense strand comprises SEQ ID NO: 334 or the sense strand comprises SEQ ID NO:178 and the antisense strand comprises of SEQ ID NO:334 or the sense strand comprises SEQ ID NO: 180 and the antisense strand comprises SEQ ID NO: 336 or the sense strand comprises SEQ ID NO: 163 and the antisense strand comprises SEQ ID NO: 319 or the sense strand comprises SEQ ID NO: 161 and the antisense strand comprises SEQ ID NO: 317 or the sense strand comprises SEQ ID NO: 174 and the antisense strand comprises SEQ ID NO: 330 or the sense strand comprises SEQ ID NO: 166 and the antisense strand comprises SEQ ID NO: 322. 
     
     
         16 . The pharmaceutical composition of  claim 14 , wherein the sense strand consists of SEQ ID NO:178 and the antisense strand consists of SEQ ID NO: 334 or the sense strand consists of SEQ ID NO: 180 and the antisense strand consists of SEQ ID NO: 336 or the sense strand consists of SEQ ID NO: 163 and the antisense strand consists of SEQ ID NO: 319 or the sense strand consists of SEQ ID NO: 161 and the antisense strand consists of SEQ ID NO: 317 or the sense strand consists of SEQ ID NO: 174 and the antisense strand consists of SEQ ID NO: 330 or the sense strand consists of SEQ ID NO: 166 and the antisense strand consists of SEQ ID NO: 322. 
     
     
         17 . A method for inhibiting the expression of the E6AP gene in a cell, the method comprising:
 (a) introducing into the cell the dsRNA of  claim 2 ; and   (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the E6AP gene, thereby inhibiting expression of the E6AP gene in the cell.   
     
     
         18 . A cell comprising the dsRNA of  claim 2 . 
     
     
         19 . A vector for inhibiting the expression of the E6AP gene in a cell, said vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of the dsRNA of  claim 2 . 
     
     
         20 . A cell comprising the vector of  claim 19 .