Combination motif immune stimulatory oligonucleotides with improved activity

Abstract

Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.

1 .- 20 . (canceled) 
     
     
         21 . An immunostimulatory oligonucleotide having a base sequence comprising 5′ T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3′ (SEQ ID NO: 2), wherein each * represents a stabilized internucleotide linkage and _ represents a phosphodiester or phosphodiester-like internucleotide linkage. 
     
     
         22 . The immunostimulatory oligonucleotide according to  claim 21 , wherein each * in SEQ ID NO: 2 represents a phosphorothioate internucleotide linkage and _ represents a phosphodiester internucleotide linkage. 
     
     
         23 . An immunostimulatory oligonucleotide having a base sequence comprising 5′ T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3′ (SEQ ID NO: 3), wherein each * represents a stabilized internucleotide linkage and the oligonucleotide is 23-26 nucleotides in length. 
     
     
         24 . The immunostimulatory oligonucleotide according to  claim 23 , wherein each * in SEQ ID NO: 3 represents a phosphorothioate internucleotide linkage. 
     
     
         25 . An immunostimulatory oligonucleotide having a base sequence comprising 5′ TCGTCGTTTTCGGCGCGCGCCGTX 1 X 2 X 3 X 4  3′ (SEQ ID NO: 6), wherein each C is unmethylated, X 1 , X 2 , X 3 , and X 4  are each independently a nucleotide base, and X 1 X 2 X 3 X 4  is not TTTT. 
     
     
         26 . A pharmaceutical composition comprising an immunostimulatory oligonucleotide according to  claim 21 , a pharmaceutically acceptable carrier, and an optional antigen. 
     
     
         27 . A method of treating a disorder or condition in a subject comprising administering to the subject in need of treatment an effective amount of an immunostimulatory oligonucleotide according to  claim 21 , wherein the disease or condition is selected from an infection, an allergic condition, and cancer.