US2012322862A1PendingUtilityA1

Aptamers to 4-1BB and Their Use in Treating Diseases and Disorders

40
Assignee: VAUGHT JONATHANPriority: Mar 3, 2010Filed: Mar 3, 2011Published: Dec 20, 2012
Est. expiryMar 3, 2030(~3.6 yrs left)· nominal 20-yr term from priority
A61P 37/08A61P 25/00C07H 19/073C12N 15/115A61P 31/00C07H 19/10C07H 21/04A61K 31/7115
40
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The present disclosure relates generally to the field of nucleic acids and, more particularly, to aptamers capable of binding to 4-1BB; pharmaceutical compositions comprising such 4-1BB aptamers; and methods of making and using the same.

Claims

exact text as granted — not AI-modified
1 . A composition comprising: 
       
         
           
                 
                 
               
                     
                   CCCWCWAGX 
                 
             
                
               
            
           
         
         wherein 
         X=G or C; 
         W is an independently selected modified pyrimidine; and 
         C is an independently selected modified cytidine. 
       
     
     
         2 . A composition comprising 
       
         
           
                 
                 
               
                     
                   YCGGAWGZ 
                 
             
                
               
            
           
         
         wherein 
         X=G or C; 
         Y=C or G; 
         Z=C or W 
         W is an independently selected modified pyrimidine; and 
         C is an independently selected modified cytidine. 
       
     
     
         3 . The composition of  claim 1  or  2 , wherein said modified pyrimidine is a C-5 modified pyrimidine and said modified cytidine is a C-5 modified cytidine. 
     
     
         4 . The composition of  claim 3  wherein said C-5 modified pyrimidine is selected from the group consisting of  FIG. 3 . 
     
     
         5 . The composition of  claim 3 , wherein said C-5 modified pyrimidine is selected from the group consisting of 5-(N-benzylcarboxyamide)-2′-deoxyuridine (BndU), 5-(N-isobutylcarboxyamide)-2′-deoxyuridine (iBudU), 5-(N-tryptaminocarboxyamide)-2′-deoxyuridine (TrpdU) and 5-(N-naphthylmethylcarboxyamide)-2′-deoxyuridine (NapdU). 
     
     
         6 . The composition of  claim 3 , wherein said C-5 modified pyrimidine is 5-(N-tryptaminocarboxyamide)-2′-deoxyuridine (TrpdU). 
     
     
         7 . The composition of  claims 3  to  6 , wherein said C-5 modified cytidine is 5-methylcytidine. 
     
     
         8 . An aptamer comprised of a sequence selected from: 
       
         
           
                 
                 
               
                     
                   5′-5 f(n) -CCCWCWAGX-L1 (n) -YCGGAWGZ-3 f(n) -3′ 
                 
                     
                     
                 
                     
                   3′-3 f(n) -CCCWCWAGX-L2 (n) -YCGGAWGZ-5 f(n) -5′ 
                 
             
                
                
                
               
            
           
         
         wherein 
         X=G or C; 
         Y=G or C; 
         Z=C or W; 
         wherein 
         W is an independently selected modified pyrimidine; and 
         C is an independently selected modified cytidine; 
         wherein 
         3 f , 5 f , L1 and L2 are independently selected from a nucleotide (N), a spacer sequence, or a combination thereof; 
         wherein said spacer sequence is selected from a non-nucleotide small molecule covalently bound to either end of the consensus regions; and 
         n=an integer from 0-100. 
       
     
     
         9 . The aptamer of  claim 8 , wherein said modified pyrimidine is a C-5 modified pyrimidine and said modified cytidine is a C-5 modified cytidine. 
     
     
         10 . The aptamer of  claim 9 , wherein said C-5 modified pyrimidine is selected from the group consisting of  FIG. 3 . 
     
     
         11 . The aptamer of  claim 9 , wherein said C-5 modified pyrimidine is selected from the group consisting of 5-(N-benzylcarboxyamide)-2′-deoxyuridine (BndU), 5-(N-isobutylcarboxyamide)-2′-deoxyuridine (iBudU), 5-(N-tryptaminocarboxyamide)-2′-deoxyuridine (TrpdU) and 5-(N-naphthylmethylcarboxyamide)-2′-deoxyuridine (NapdU). 
     
     
         12 . The aptamer of  claim 8 , wherein said C-5 modified pyrimidine is 5-(N-tryptaminocarboxyamide)-2′-deoxyuridine (TrpdU). 
     
     
         13 . The aptamer of  claims 8 - 12 , wherein said C-5 modified cytidine is 5-methylcytidine. 
     
     
         14 . The aptamer of  claims 8 - 13 , wherein said small molecules form a spacer sequence selected from the group consisting of a polyethylene glycol, a hydrocarbon chain, or other polymer or copolymer. 
     
     
         15 . An aptamer comprised of the sequence 5′-CCCTCTAGXN (0-40) YCGGATGZ-3′ or a fragment thereof:
 wherein 
 X=G or C; 
 Y=G or C; 
 Z=C or T; 
 T=TrpdU; 
 C=MdC 
 N is independently selected from a naturally occurring nucleotide, a modified nucleotide, or a spacer sequence. 
 
     
     
         16 . The aptamer of  claims 8 - 15 , wherein the aptamer binds to 4-1BB. 
     
     
         17 . The aptamer of  claim 16 , wherein said aptamer has a Kd for 1-1BB of 50 nm or less. 
     
     
         18 . The aptamer of  claim 16 , wherein said aptamer has the ability to inhibit the binding of 4-1BB to a 4-1BB receptor ligand (4-1BBL). 
     
     
         19 . An aptamer that binds to 4-1BB comprising a sequence selected from the group consisting of SEQ. ID. NOS: 4-13. 
     
     
         20 . The aptamer of  claim 19 , wherein said aptamer has the ability to inhibit the binding of 4-1BB to a 4-1BB receptor ligand (4-1BBL). 
     
     
         21 . The aptamer of  claim 20 , wherein the sequence is selected from the group consisting of at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, and at least about 95% identity. 
     
     
         22 . A pharmaceutical composition comprising an aptamer to 4-1BB comprised of the sequence 5′-CCCTCTAGXN (0-40) YCGGATGZ-3′, or a pharmaceutically acceptable salt thereof or a fragment thereof:
 wherein 
 X=G or C; 
 Y=G or C; 
 Z=C or T; 
 T=TrpdUTP; 
 C=MdC 
 N is independently selected from a naturally occurring oligonucleotide, a modified nucleotide, or a small molecule. 
 
     
     
         23 . A pharmaceutical composition comprising an aptamer to 4-1BB comprised of the sequences selected from the group consisting of SEQ. ID. NOS: 4-13, or a pharmaceutically acceptable salt thereof or a fragment thereof. 
     
     
         24 . A pharmaceutical composition comprising an aptamer to 4-1BB comprised of the sequence CCTGCACCCAGTGTCCCCGACGGGGCCCTCTAGCCGTACTCTGTAATGG CGGATGCTGACGGAGAGGAGGACGG (SEQ ID NO:5); or a pharmaceutically acceptable salt thereof or a fragment thereof. 
     
     
         25 . The compositions of  claims 22  to  24 , further comprising a pharmaceutically acceptable carrier or excipient.

Cited by (0)

No later patents cite this yet.

References (0)

No backward citations on record.