US2013122016A1PendingUtilityA1

Methods and Compositions for Prognosing, Detecting, and Treating Age-Related Macular Degeneration

50
Individually held — no corporate assignee on recordPriority: Feb 16, 2007Filed: Jul 9, 2012Published: May 16, 2013
Est. expiryFeb 16, 2027(~0.5 yrs left)· nominal 20-yr term from priority
Inventors:Margaret M. Deangelis
C12Q 2600/172A61P 27/00C12Q 1/6883
50
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The invention provides methods and compositions for determining whether a subject is at risk of developing age-related macular degeneration, for example, the wet or neovascular form of age-related macular degeneration. The method involves determining whether the subject has a protective variant and/or a risk variant at a polymorphic site in the HTRA1 gene. In addition, the invention provides a method of treating or slowing the progression of age-related macular degeneration by reducing the expression of the HTRA1 gene, or reducing the biological activity of the HTRA1 gene product.

Claims

exact text as granted — not AI-modified
1 . A method of determining a subject's risk of developing age-related macular degeneration, the method comprising determining whether the subject has a protective variant at a polymorphic site of the HTRA1 gene, wherein, if the subject has at least one protective variant, the subject is less likely to develop age-related macular degeneration than a person without the protective variant. 
     
     
         2 . The method of  claim 1 , further comprising determining the genotype at the polymorphic site of the subject. 
     
     
         3 . The method of  claim 2 , wherein the subject, if heterozygous for the protective variant, has a 8-fold lower risk of developing age-related macular degeneration than a homozygous person without the protective variant. 
     
     
         4 . The method of  claim 2 , wherein the subject, if homozygous for the protective variant, has a 33-fold lower risk of developing age-related macular degeneration than a homozygous person without the protective variant. 
     
     
         5 . The method of  claim 1 , wherein the polymorphic site is located in the promoter region of the HTRA1 gene. 
     
     
         6 . The method of  claim 5 , wherein the polymorphic site is rs2672598. 
     
     
         7 . The method of  claim 6 , wherein for the rs2672598 polymorphic site, the forward sequence comprises CTGCCCGGCCCAGTCCGAGCX 1 TCCCGGGCGGGCCCCCAGTC (SEQ ID NO. 1) wherein X 1  is a C to a T substitution and/or the reverse sequence comprises GACTGGGGGCCCGCCCGGGAX 2 GCTCGGACTGGGCCGGGCAG (SEQ ID NO. 2) wherein X 2  is a G to A substitution. 
     
     
         8 . The method of  claim 2 , wherein the genotype is determined by direct nucleotide sequencing. 
     
     
         9 . The method of  claim 2 , wherein the genotype is determined by hybridization using a hybridization probe that selectively anneals to the protective variant or to the common allele at the polymorphic site of the HTRA1 gene. 
     
     
         10 . The method of  claim 2 , wherein the genotype is determined by restriction fragment length polymorphism analysis. 
     
     
         11 . The method of  claim 8 , further comprising the step of amplifying the polymorphic site prior to determining the genotype. 
     
     
         12 . The method of  claim 2 , where the genotype is determined by an amplification reaction using primers capable of amplifying the polymorphic site. 
     
     
         13 . A method of treating a subject at risk of developing, or having, age-related macular degeneration, the method comprising (i) reducing the expression of the HTRA1 gene or (ii) reducing the biological activity of the HTRA1 gene product. 
     
     
         14 . A method of slowing the progression of age-related macular degeneration in a subject, the method comprising (i) reducing the expression of the HTRA1 gene or (ii) reducing the biological activity of the HTRA1 gene product. 
     
     
         15 . The method of  claim 13 , wherein the expression of the HTRA1 gene is reduced by administering to the subject an amount of an anti-sense polynucleotide or a siRNA effective to reduce the expression of the HTRA1 gene. 
     
     
         16 . The method of  claim 13 , wherein the biological activity of the HTRA1 gene product is reduced by administering to the subject an effective amount of a binding protein that binds to the HTRA1 gene product thereby to reduce the activity of the HTRA1 gene product. 
     
     
         17 . The method of  claim 16 , wherein the binding protein is an antibody. 
     
     
         18 . The method of  claim 1 , wherein the subject is a human. 
     
     
         19 - 43 . (canceled)

Join the waitlist — get patent alerts

Track US2013122016A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.