US2013184170A1PendingUtilityA1

Oligonucleotide amplification primers for targeting oncogenic hpv

53
Assignee: PARK DANIEL JPriority: Apr 5, 2007Filed: Jun 4, 2012Published: Jul 18, 2013
Est. expiryApr 5, 2027(~0.7 yrs left)· nominal 20-yr term from priority
C12Q 1/701C12Q 1/708
53
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The present invention relates generally to the field of diagnostic and detection assays. More particularly, the present invention provides methods and reagents including biochips for detecting the presence of, or distinguishing between, one or more analytes in a sample.

Claims

exact text as granted — not AI-modified
What is claimed: 
     
         1 . A headset for detecting a strain of HPV and/or for differentiating between two or more strains of HPV, wherein the headset comprises a plurality of families or a plurality of subsets of beads having:
 (a) at least two subsets of beads, wherein each subset of beads is physiochemically distinguishable from any other bead subset based on at least size; or   (b) at least one subset of beads having at least two families, wherein the beads in a bead subset are homogeneous in size with respect to each other, and are physiochemically distinguishable into two or more families of beads based on the level of labelling each contains, or   (c) a combination of said families of beads and said subsets of beads; and wherein:   the beads within each bead family of a subset are each coupled to an optionally-labelled nucleic acid capture probe capable of binding to a HPV strain-specific region of an HPV genome or, optionally, to at least one of a control nucleic acid sequence, provided that any nucleic acid capture probe or control nucleic acid sequence is labelled with the same label as other labelled capture probes or control nucleic acid sequence in the bead subset, and that within any single subset of beads, each family of beads thereof has a different fluorescent intensity; and   each family of beads is specific for the detection of a strain of HPV different from any other bead family in the beadset; wherein said beadset is capable of identifying one or more specific strains of HPV through analysis of bead size, fluorescent intensity, or sequence discrimination of the at least one bead family or bead subset, using flow cytometry.   
     
     
         2 . The beadset of  claim 1 , wherein the bead sizes are selected from the group consisting of: 3.0 μm, 3.5 μm, 4.1 μm, 5.0 μm, 5.6 μm and 6.8 μm. 
     
     
         3 . The beadset of  claim 1 , wherein the bead sizes are selected from the group consisting of: 3.0 μm, 3.5 μm, 3.77 μm, 5.0 μm, 5.6 μm and 6.8 μm. 
     
     
         4 . The beadset of  claim 1  wherein the labelled beads are labelled with a fluorochrome selected from the group consisting of: hydroxycoumarin, aminocoumarin, methoxycoumarin, cascade blue, Lucifer yellow, NBD, Phycoerythrin (PE), PerCP, allophycocyanin, Hoechst 33342, DAP1, SYTOX Blue, Hoechst 33258, chromomycin A3, mithramycin, YOYO-I, SYTOX green, SYTOX orange, 7-AAD, acridine orange, TOTO-1, To-PRO-1, thiazole orange, TOTO-3, TO-PRO-3, LDS 751, Alexa Fluoro-350, Alexa Fluoro-430, Alexa Fluoro-488, Alexa Fluoro-532, Alexa Fluoro-546, Alexa Fluoro-555, Alexa Fluoro-556, Alexa Fluoro-594, Alexa Fluoro-633, Alexa Fluoro-647, Alexa Fluoro-660, Alexa Fluoro-680, Alexa Fluoro-700 and Alexa Fluoro-750, BoDipy 630/650 and BoDipy 650/665, the CY dyes Cy2, Cy3, Cy3.5, Cy5, Cy 5.5 and Cy7, 6-FAM (Fluorescein), PE-Cy5, PE-Cy7, Fluorescein dT, Hexachlorofluorescein (Hex), 6-carboxy-4′,5′-dichloro-2′, 7-dimethoxyfluorescein (JOE), Oregon green dyes 488-X and 514, Rhodamine dyes X-Rhodamine, Lissamine Rhodamine B, Rhodamine Green, Rhodamine Red, and ROX, TRITC, Tetramethylrhodamine (TMR), Carboxytetramethylrhodamine (TAMRA), Tetrachlorofluorescein (TET), Red 6B, Fluor X, BODIPY-FL, SYBR Green I dye, and Texas Red. 
     
     
         5 . The beadset of  claim 4  wherein the labelled beads are labelled with TMR. 
     
     
         6 . The beadset of  claim 1  comprising to 2 to 17 families of beads. 
     
     
         7 . The beadset of  claim 1 , wherein the beadset comprises 17 families of beads. 
     
     
         8 . The beadset of  claim 1  wherein the two or more HPV strains are selected from the group consisting of strains 6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68. 
     
     
         9 . The beadset of  claim 1 , wherein the nucleic acid capture probe is selected from the list of sequences of Table 2. 
     
     
         10 . A method for preparing a headset for use in detecting a strain of HPV and/or differentiating between two or more strains of HPV, the method comprising selecting a plurality of families or subsets of beads based on size, fluorescent intensity, or both, comprising providing:
 (a) at least two subsets of beads, wherein each subset of beads is physiochemically distinguishable from any other bead subset based on at least size; or   (b) at least one subset of beads having at least two families, wherein the beads in a bead subset are homogeneous in size with respect to each other, and are physiochemically distinguishable into two or more families of beads based on the level of labelling each contains, or   (c) a combination of said families of beads and said subsets of beads; and wherein:   the beads within each bead family of a subset are each coupled to an optionally-labelled nucleic acid capture probe capable of binding to a HPV strain-specific region of an HPV genome or, optionally, to at least one of a control nucleic acid sequence, provided that any nucleic acid capture probe or control nucleic acid sequence is labelled with the same label as other labelled capture probes or control nucleic acid sequence in the bead subset, and that within any single subset of beads, each family of beads thereof has a different fluorescent intensity; and   each family of beads is specific for the detection of a strain of HPV different from any other bead family in the beadset; and   mixing the at least two families or at least two subsets of beads together to produce a beadset that permits identification of a specific strain of HPV through analysis of bead size, fluorescent intensity, or sequence discrimination of the at least one bead family or bead subset, using flow cytometry.   
     
     
         11 . A method for diagnosing HPV infection in a human subject, said method comprising:
 (i) obtaining a biological sample from the human subject which putatively comprises HPV;   (ii) isolating nucleic acid from said sample;   (iii) amplifying the nucleic acid from said sample using primers which generate an amplicon which is distinct for said analyte or a particular strain of said analyte;   (iv) optionally amplifying a control nucleic acid sequence from the genomic DNA of the human subject;   (v) optionally effecting labelling of the amplicon(s) recited at steps (iii) and/or (iv);   (vi) hybridizing the labelled amplicon(s) to a beadset of reactants wherein each member of the beadset comprises a nucleic acid molecule having complementarity to a nucleotide sequence of HPV or a particular strain of HPV or a control nucleotide sequence, bound or otherwise associated with a physiochemically distinguishable substrate; and   (vii) determining to which of the reactants an amplicon has bound; wherein the association of an amplicon with a particular reactant is indicative of HPV infection in the human subject.   
     
     
         12 . A method for determining the risk of a human subject developing a disease associated with one or more strains of HPV said method comprising:
 (i) obtaining a biological sample from the human subject which putatively comprises HPV;   (ii) isolating nucleic acid from said sample;   (iii) amplifying the nucleic acid from said sample using primers which generate an amplicon which is distinct for said analyte or a particular strain of said analyte;   (iv) optionally amplifying a control nucleic acid sequence from the genomic DNA of the human subject;   (v) optionally effecting labelling of the amplicon(s) recited at steps (iii) and/or (iv);   (vi) hybridizing the labelled amplicon(s) to a beadset of reactants wherein each member of the beadset comprises a nucleic acid molecule having complementarity to a nucleotide sequence of HPV or a particular strain of HPV or a control nucleotide sequence, bound or otherwise associated with a physiochemically distinguishable substrate; and   (vii) determining to which of the reactants an amplicon has bound; wherein the association of an amplicon with a particular reactant comprising a polynucleotide which is complementary to a strain of HPV associated with a particular disease, is indicative of an increased risk said disease in the subject.   
     
     
         13 . A method for diagnosing HPV infection in a human subject, said method comprising:
 (i) obtaining a biological sample from the human subject which putatively comprises HPV;   (ii) isolating nucleic acid from said sample;   (iii) amplifying the nucleic acid from said sample using primers which generate an amplicon which is distinct for said analyte or a particular strain of said analyte;   (iv) optionally amplifying a control nucleic acid sequence from the genomic DNA of the human subject;   (v) hybridizing the labelled amplicon(s) to a beadset of reactants wherein each member of the beadset comprises a nucleic acid molecule having complementarity to a nucleotide sequence of HPV or a particular strain of HPV or a control nucleotide sequence, bound or otherwise associated with a physiochemically distinguishable substrate and wherein the hybridizing occurs in the presence of at least one signal oligonucleotide sequence; and   (vi) determining to which of the reactants an amplicon has bound; wherein the association of an amplicon with a particular reactant is indicative of HPV infection in the human subject.   
     
     
         14 . A method of  claim 13 , wherein the beadset of reactants comprises a plurality of families or a plurality of subsets of beads having:
 (a) at least two subsets of beads, wherein each subset of beads is physiochemically distinguishable from any other bead subset based on at least size; or   (b) at least one subset of beads having at least two families, wherein the beads in a bead subset are homogeneous in size with respect to each other, and are physiochemically distinguishable into two or more families of beads based on the level of labelling each contains, or   (c) a combination of said families of beads and said subsets of beads; and wherein:   the beads within each bead family of a subset are each coupled to an optionally-labelled nucleic acid capture probe capable of binding to a HPV strain-specific region of an HPV genome or, optionally, to at least one of a control nucleic acid sequence, provided that any nucleic acid capture probe or control nucleic acid sequence is labelled with the same label as other labelled capture probes or control nucleic acid sequence in the bead subset, and that within any single subset of beads, each family of beads thereof has a different fluorescent intensity; and   each family of beads is specific for the detection of a strain of HPV different from any other bead family in the beadset; wherein said beadset is capable of identifying one or more specific strains of HPV through analysis of bead size, fluorescent intensity, or sequence discrimination of the at least one bead family or bead subset, using flow cytometry.   
     
     
         15 . A method for determining the risk of a human subject developing a disease associated with one or more strains of HPV said method comprising:
 (i) obtaining a biological sample from the human subject which putatively comprises HPV;   (ii) isolating nucleic acid from said sample;   (iii) amplifying the nucleic acid from said sample using primers which generate an amplicon which is distinct for said analyte or a particular strain of said analyte;   (iv) optionally amplifying a control nucleic acid sequence from the genomic DNA of the human subject;   (v) hybridizing the labelled amplicon(s) to a beadset of reactants wherein each member of the beadset comprises a nucleic acid molecule having complementarity to a nucleotide sequence of HPV or a particular strain of HPV or a control nucleotide sequence, bound or otherwise associated with a physiochemically distinguishable substrate and wherein the hybridizing occurs in the presence of at least one signal oligonucleotide sequence; and   (vi) determining to which of the reactant an amplicon has bound; wherein the association of an amplicon with a particular reactant comprising a polynucleotide which is complementary to a strain of HPV associated with a particular disease, is indicative of an increased risk said disease in the subject.   
     
     
         16 . A method of  claim 15 , wherein the beadset of reactants comprises a plurality of families or a plurality of subsets of beads having:
 (a) at least two subsets of beads, wherein each subset of beads is physiochemically distinguishable from any other bead subset based on at least size; or   (b) at least one subset of beads having at least two families, wherein the beads in a bead subset are homogeneous in size with respect to each other, and are physiochemically distinguishable into two or more families of beads based on the level of labelling each contains, or   (c) a combination of said families of beads and said subsets of beads; and wherein:   the beads within each bead family of a subset are each coupled to an optionally-labelled nucleic acid capture probe capable of binding to a HPV strain-specific region of an HPV genome or, optionally, to at least one of a control nucleic acid sequence, provided that any nucleic acid capture probe or control nucleic acid sequence is labelled with the same label as other labelled capture probes or control nucleic acid sequence in the bead subset, and that within any single subset of beads, each family of beads thereof has a different fluorescent intensity; and   each family of beads is specific for the detection of a strain of HPV different from any other bead family in the beadset; wherein said beadset is capable of identifying one or more specific strains of HPV through analysis of bead size, fluorescent intensity, or sequence discrimination of the at least one bead family or bead subset, using flow cytometry.   
     
     
         17 . A method for diagnosing HPV infection in a human subject, said method comprising:
 (i) obtaining a biological sample from the human subject which putatively comprises HPV;   (ii) isolating nucleic acid from said sample;   (iii) amplifying the nucleic acid from said sample using primers which generate an amplicon which is distinct for said analyte or a particular strain of said analyte;   (iv) optionally amplifying a control nucleic acid sequence from the genomic DNA of the human subject;   (v) optionally effecting labelling of the amplicon(s) recited at steps (iii) and/or (iv);   (vi) hybridizing the labelled amplicon(s) to a beadset of reactants wherein each member of the beadset comprises a nucleic acid molecule having complementarity to a nucleotide sequence of HPV or a particular strain of HPV or a control nucleotide sequence, bound or otherwise associated with a physiochemically distinguishable substrate and wherein the hybridizing occurs in the presence of at least one blocking oligonucleotide sequence; and   (vii) determining to which of the reactants an amplicon has bound; wherein the association of an amplicon with a particular reactant is indicative of HPV infection in the human subject.   
     
     
         18 . A method of  claim 17 , wherein the beadset of reactants comprises a plurality of families or a plurality of subsets of beads having:
 (a) at least two subsets of beads, wherein each subset of beads is physiochemically distinguishable from any other bead subset based on at least size; or   (b) at least one subset of beads having at least two families, wherein the beads in a bead subset are homogeneous in size with respect to each other, and are physiochemically distinguishable into two or more families of beads based on the level of labelling each contains, or   (c) a combination of said families of beads and said subsets of beads; and wherein:   the beads within each bead family of a subset are each coupled to an optionally-labelled nucleic acid capture probe capable of binding to a HPV strain-specific region of an HPV genome or, optionally, to at least one of a control nucleic acid sequence, provided that any nucleic acid capture probe or control nucleic acid sequence is labelled with the same label as other labelled capture probes or control nucleic acid sequence in the bead subset, and that within any single subset of beads, each family of beads thereof has a different fluorescent intensity; and   each family of beads is specific for the detection of a strain of HPV different from any other bead family in the beadset; wherein said beadset is capable of identifying one or more specific strains of HPV through analysis of bead size, fluorescent intensity, or sequence discrimination of the at least one bead family or bead subset, using flow cytometry.   
     
     
         19 . A method for determining the risk of a human subject developing a disease associated with one or more strains of HPV said method comprising:
 (i) obtaining a biological sample from the human subject which putatively comprises HPV;   (ii) isolating nucleic acid from said sample;   (iii) amplifying the nucleic acid from said sample using primers which generate an amplicon which is distinct for said analyte or a particular strain of said analyte;   (iv) optionally amplifying a control nucleic acid sequence from the genomic DNA of the human subject;   (v) optionally effecting labelling of the amplicon(s) recited at steps (iii) and/or (iv);   (vi) hybridizing the labelled amplicon(s) to a beadset of reactants wherein each member of the beadset comprises a nucleic acid molecule having complementarity to a nucleotide sequence of HPV or a particular strain of HPV or a control nucleotide sequence, bound or otherwise associated with a physiochemically distinguishable substrate and wherein the hybridizing occurs in the presence of at least one blocking oligonucleotide sequence; and   (vii) determining to which of the reactant an amplicon has bound; wherein the association of an amplicon with a particular reactant comprising a polynucleotide which is complementary to a strain of HPV associated with a particular disease, is indicative of an increased risk said disease in the subject.   
     
     
         20 . A method of  claim 19 , wherein the beadset of reactants comprises a plurality of families or a plurality of subsets of beads having:
 (a) at least two subsets of beads, wherein each subset of beads is physiochemically distinguishable from any other bead subset based on at least size; or   (b) at least one subset of beads having at least two families, wherein the beads in a bead subset are homogeneous in size with respect to each other, and are physiochemically distinguishable into two or more families of beads based on the level of labelling each contains, or   (c) a combination of said families of beads and said subsets of beads; and wherein:   the beads within each bead family of a subset are each coupled to an optionally-labelled nucleic acid capture probe capable of binding to a HPV strain-specific region of an HPV genome or, optionally, to at least one of a control nucleic acid sequence, provided that any nucleic acid capture probe or control nucleic acid sequence is labelled with the same label as other labelled capture probes or control nucleic acid sequence in the bead subset, and that within any single subset of beads, each family of beads thereof has a different fluorescent intensity; and   each family of beads is specific for the detection of a strain of HPV different from any other bead family in the beadset; wherein said beadset is capable of identifying one or more specific strains of HPV through analysis of bead size, fluorescent intensity, or sequence discrimination of the at least one bead family or bead subset, using flow cytometry.   
     
     
         21 . A method for diagnosing HPV infection in a human subject, said method comprising:
 (i) obtaining a biological sample from the human subject which putatively comprises HPV;   (ii) isolating nucleic acid from said sample;   (iii) amplifying the nucleic acid from said sample using primers which generate an amplicon which is distinct for said analyte or a particular strain of said analyte;   (iv) optionally amplifying a control nucleic acid sequence from the genomic DNA of the human subject;   (v) hybridizing the labelled amplicon(s) to a beadset of reactants wherein each member of the beadset comprises a nucleic acid molecule having complementarity to a nucleotide sequence of HPV or a particular strain of HPV or a control nucleotide sequence, bound or otherwise associated with a physiochemically distinguishable substrate and wherein the hybridizing occurs in the presence of at least one signal oligonucleotide sequence and at least one blocking oligonucleotide sequence; and   (vi) determining to which of the reactants an amplicon has bound; wherein the association of an amplicon with a particular reactant is indicative of HPV infection in the human subject.   
     
     
         22 . A method of  claim 13 , wherein the beadset of reactants a plurality of families or a plurality of subsets of beads having:
 (a) at least two subsets of beads, wherein each subset of beads is physiochemically distinguishable from any other bead subset based on at least size; or   (b) at least one subset of beads having at least two families, wherein the beads in a bead subset are homogeneous in size with respect to each other, and are physiochemically distinguishable into two or more families of beads based on the level of labelling each contains, or   (c) a combination of said families of beads and said subsets of beads; and wherein:   the beads within each bead family of a subset are each coupled to an optionally-labelled nucleic acid capture probe capable of binding to a HPV strain-specific region of an HPV genome or, optionally, to at least one of a control nucleic acid sequence, provided that any nucleic acid capture probe or control nucleic acid sequence is labelled with the same label as other labelled capture probes or control nucleic acid sequence in the bead subset, and that within any single subset of beads, each family of beads thereof has a different fluorescent intensity; and   each family of beads is specific for the detection of a strain of HPV different from any other bead family in the beadset; wherein said beadset is capable of identifying one or more specific strains of HPV through analysis of bead size, fluorescent intensity, or sequence discrimination of the at least one bead family or bead subset, using flow cytometry.   
     
     
         23 . A method for determining the risk of a human subject developing a disease associated with one or more strains of HPV said method comprising:
 (i) obtaining a biological sample from the human subject which putatively comprises HPV;   (ii) isolating nucleic acid from said sample;   (iii) amplifying the nucleic acid from said sample using primers which generate an amplicon which is distinct for said analyte or a particular strain of said analyte;   (iv) optionally amplifying a control nucleic acid sequence from the genomic DNA of the human subject;   (v) hybridizing the labelled amplicon(s) to a beadset of reactants wherein each member of the beadset comprises a nucleic acid molecule having complementarity to a nucleotide sequence of HPV or a particular strain of HPV or a control nucleotide sequence, bound or otherwise associated with a physiochemically distinguishable substrate and wherein the hybridizing occurs in the presence of at least one signal oligonucleotide sequence and at least one blocking oligonucleotide sequence; and   (vi) determining to which of the reactant an amplicon has bound; wherein the association of an amplicon with a particular reactant comprising a polynucleotide which is complementary to a strain of HPV associated with a particular disease, is indicative of an increased risk said disease in the subject.   
     
     
         24 . A method of  claim 13 , wherein the beadset of reactants a plurality of families or a plurality of subsets of beads having:
 (a) at least two subsets of beads, wherein each subset of beads is physiochemically distinguishable from any other bead subset based on at least size; or   (b) at least one subset of beads having at least two families, wherein the beads in a bead subset are homogeneous in size with respect to each other, and are physiochemically distinguishable into two or more families of beads based on the level of labelling each contains, or   (c) a combination of said families of beads and said subsets of beads; and wherein:   the beads within each bead family of a subset are each coupled to an optionally-labelled nucleic acid capture probe capable of binding to a HPV strain-specific region of an HPV genome or, optionally, to at least one of a control nucleic acid sequence, provided that any nucleic acid capture probe or control nucleic acid sequence is labelled with the same label as other labelled capture probes or control nucleic acid sequence in the bead subset, and that within any single subset of beads, each family of beads thereof has a different fluorescent intensity; and   each family of beads is specific for the detection of a strain of HPV different from any other bead family in the beadset; wherein said beadset is capable of identifying one or more specific strains of HPV through analysis of bead size, fluorescent intensity, or sequence discrimination of the at least one bead family or bead subset, using flow cytometry.   
     
     
         25 . An oligonucleotide amplification primer pair for targeting oncogenic HPV, wherein the forward primer of the primer pair is selected from the group consisting of: 
       
         
           
                 
                 
               
                     
                   TR TTT GTT ACT GTK GTD GAT ACY A; 
                 
                     
                     
                 
                     
                   CAR YTR TTT GTT ACT GTK GTD GAT A; 
                 
                     
                     
                 
                     
                   CAR YTR TTT GTT ACT GTK GTD GA; 
                 
                     
                     
                 
                     
                   AAY CAR YTR TTT GTT ACT GTK GT; 
                 
                     
                     
                 
                     
                   TTT GTT ACT GTK GTD GAT ACY AC HCG; 
                 
                     
                     
                 
                     
                   TTT GTT ACT GTK GTD GAT ACY AC HCG YAG; 
                 
                     
                     
                 
                     
                   GTK GTD GAT ACY AC HCG YAG TAC 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   GTD GAT ACY AC HCG YAG TAC HAA; 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
         and the reverse primer of the primer pair is selected from the group consisting of: 
       
       
         
           
                 
               
                   TGA AAA ATA AAY TGY AAA TCA TAT TCY TCM MCA TG; 
                 
                     
                 
                   CAY ARY TGA AAA ATA AAY TGY AAA TC; 
                 
                     
                 
                   TR CAY ARY TGA AAA ATA AAY TG; 
                 
                   and 
                 
                     
                 
                   TR CAY ARY TGA AAA ATA AA; 
                 
             
                
                
                
                
                
                
                
                
               
            
           
         
         wherein the forward and reverse primers are each optionally conjugated to a heel at the 5′ terminus of the primer. 
       
     
     
         26 . A primer pair according to  claim 25 , wherein at least one of the forward and reverse primers is conjugated to a heel at the 5′ terminus of the primer. 
     
     
         27 . A primer pair of  claim 25 , wherein the forward primer heel is selected from the group consisting of:
 CAATCAGC, ACAAT, GGAACAAT, GGAAC, CAGCTT, ATTACC, CTGTT, /5 Phos/CAATCAGC, /5 Phos/ACAAT, /5 Phos/GGAACAAT, /5 Phos/GGAAC, /5Phos/CAGCTT, 5Phos/ATTACC, and /5Phos/CTGTT.   
     
     
         28 . A primer pair of  claim 25 , wherein the reverse primer heel is selected from the group consisting of:
 ACTCACTATAGG, AATACGACTCACTATAGG, TCTAATACGACTCACTATAGG, AATTCTAATACGACTCACTATAGG, /5 AmMC6/ACTCACTATAGG, /5 AmMC6/AATACGACTCACTATAGG, /5 AmMC6/TCTAATACGACTCACTATAGG, and /5 AmMC6/AATTCTAATACGACTCACTATAGG.   
     
     
         29 . An oligonucleotide amplification primer pair of  claim 25 , containing an optional heel nucleic acid sequence, wherein the forward primer of the primer pair is selected from the group consisting of:
 CAR YTR TTT GTT ACT GTK GTD GA, optionally having a ACAAT, /5Phos/ACAAT, GGAACAAT, or a /5Phos/GGAACAAT conjugated to the 5′ terminus of the primer; and   GTD GAT ACY AC HCG YAG TAC HAA, optionally having a CTGTT or /5 Phos/CTGTT conjugated to the 5′ terminus of the primer.   
     
     
         30 . An oligonucleotide amplification primer pair of  claim 25 , containing an optional heel nucleic acid sequence, wherein the reverse primer of the primer pair is selected from the group consisting of:
 TGA AAA ATA AAY TGY AAA TCA TAT TCY TCM MCA TG, optionally having a ACTCACTATAGG or /5AmMC6/ACTCACTATAGG conjugated to the 5′ terminus of the primer,   TR CAY ARY TGA AAA ATA AAY TG, optionally having a TCTAATACGACTCACTATAGG or   /5AmMC6/TCTAATACGACTCACTATAGG conjugated to the 5′ terminus of the primer; and   TR CAY ARY TGA AAA ATA AAY TG, optionally having a TCTAATACGACTCACTATAGG or   
       /5AmMC6/TCTAATACGACTCACTATAGG conjugated to the 5′ terminus of the primer.

Cited by (0)

No later patents cite this yet.

References (0)

No backward citations on record.