US2013298286A1PendingUtilityA1
Reverse Breeding
Assignee: DIRKS ROBERT HELENE GHISLAINEPriority: Aug 23, 2001Filed: Mar 10, 2013Published: Nov 7, 2013
Est. expiryAug 23, 2021(expired)· nominal 20-yr term from priority
Inventors:Robert Helene Ghislain DirksCornelis Maria Petrus Van DunKornelius ReininkJacobus Petrus Cornelis De Wit
C12N 15/01C12N 15/8218A01H 5/10
59
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
The present invention relates to a method for efficiently producing homozygous organisms from a heterozygous non-human starting organism, comprising providing of a heterozygous starting organism; allowing the starting organism to produce haploid cells; creating homozygous organisms from the haploid cells thus obtained; and selecting the organisms having the desired set of chromosomes; wherein during production of the haploid cells no recombination occurs in order to obtain a limited number of genetically different haploid cells. Recombination can also be prevented or suppressed.
Claims
exact text as granted — not AI-modified1 . A method for efficiently producing homozygous plants from a heterozygous non-human starting organism, comprising:
a) providing a heterozygous starting plant; b) allowing the starting plant to produce haploid cells; c) creating homozygous plants from the haploid cells thus obtained; and d) selecting the plants having the desired set of chromosomes; characterized in that during production of the haploid cells no recombination occurs in order to obtain a limited number of genetically different haploid cells.
2 . The method as claimed in claim 1 , wherein the recombination is at least partially prevented or suppressed
3 - 5 . (canceled)
6 . The method as claimed in claim 2 , wherein the prevention or suppression of recombination is achieved by interfering with one or more target genes involved in recombination.
7 . The method as claimed in claim 6 , wherein the target gene is selected from the group consisting of SPO11, MER1, MER2, MRE2, MEI4, REC102, REC104, REC114, MEK1/MRE4, RED1, HOP1, RAD50, MRE11, XRS2, RHD54/TID1, DMC1, SAE3, RED1, HOP1, HOP2, REC8, MER1, MRE2, ZIP1, ZIP2, MEI5, RAD51, RAD52, RAD54, RAD55, RAD57, RPA, SMC3, SCC1, MSH2, MSH3, MSH6, PMS1, SOLODANCERS, HIM6, CHK2, SGS1, MSH4, MSH5, ZIP1 AND ZIP2, or their functional homologues.
8 - 12 . (canceled)
13 . The method as claimed in claim 6 , wherein the interfering with the target gene consists of preventing transcription thereof.
14 . The method as claimed in claim 13 , wherein transcription is prevented by means of RNA oligonucleotides, DNA oligonucleotides or RNAi molecules directed against the target gene promoter.
15 . The method as claimed in claim 13 , wherein transcription is prevented by means of the expression of a negatively acting transcription factor acting on the target gene promoter.
16 . The method as claimed in claim 6 , wherein the interfering with the target gene consists of destabilizing the target gene mRNA or transcript.
17 . The method as claimed in claim 16 , wherein the target gene mRNA is destabilized by means of nucleic acid molecules that are complementary to the target gene mRNA or transcript selected from the group consisting of antisense RNA, RNAi molecules, Virus Induced Gene Silencing (VIGS) molecules, co-suppressor molecules, RNA oligonucleotides or DNA oligonucleotides.
18 . The method as claimed in claim 6 , wherein the interfering with the target gene consists of inhibiting the target gene expression product.
19 . The method as claimed in claim 18 , wherein the target gene expression product is inhibited by means of the expression product(s) of one or more dominant negative nucleic acid constructs.
20 . The method as claimed in claim 18 , wherein the target gene expression product is inhibited by means of the (over)expression of one or more suppressors which interact with the target gene product.
21 . (canceled)
22 . The method as claimed in claim 6 , wherein the interfering with the target gene consists of the introduction of one or more mutations into the target gene leading to perturbation of its biological function.
23 . The method as claimed in claim 22 , wherein the one or more mutations are introduced randomly by means of one or more chemical compounds and/or physical means and/or insertion of genetic elements.
24 . The method as claimed in claim 23 , wherein the one or more chemical compounds are selected from the group consisting of ethyl methanesulfonate, nitrosomethylurea, hydroxylamine, proflavine, N-methyl-N-nitrosoguanidine, N-ethyl-N-nitrosourea, N-methyl-N-nitro-nitrosoguanidine, diethyl sulfate, ethylene imine, sodium azide, formaline, urethane, phenol and ethylene oxide.
25 . The method as claimed in claim 23 , wherein the physical means are selected from the group consisting of UV-irradiation, fast-neutron exposure, X-rays, gamma irradiation.
26 . The method as claimed in claim 23 , wherein the genetic element is selected from the group consisting of transposons, T-DNA, retroviral elements.
27 - 28 . (canceled)
29 . The method as claimed in claim 1 , wherein the prevention or suppression of recombination is achieved by a chemical compound inducing aneuploidy.
30 . The method as claimed in claim 1 , wherein the step of creating homozygous plants from the haploid cells thus obtained is performed by means of the doubled haploid technique.
31 . The method as claimed in claim 1 , wherein the step of creating homozygous plants from the haploid cells thus obtained is performed by means of second division restitution.
32 . The method as claimed in claim 1 , wherein the step of creating homozygous plants from the haploid cells thus obtained is performed by self-pollinating the plant that contains the haploid cells to produce a population of seeds, using molecular genotyping to identify the homozygous seeds among the population and growing plants from the homozygous seeds thus identified.
33 . A homozygous plant obtained by means of the method as claimed in claim 1 .
34 . The homozygous plant as claimed in claim 33 for use as a parent in crossings.
35 . A silencing construct for modifying the expression of a target gene involved in recombination, which construct comprises suitable transcription initiation and termination sequences and a silencing DNA sequence having the nucleotide sequence of at least part of the coding strand of the target gene or the complementary sequence thereof.
36 . The construct as claimed in claim 35 , wherein the silencing DNA sequence has a nucleotide sequence that is at least 50%, preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, most preferably at least 90% homologous to the nucleotide sequence of the target gene.
37 . The construct as claimed in claim 36 , wherein the homology is determined over that part of the target gene that is essential for the biological function of its encoded protein.
38 . The construct as claimed in claim 35 , wherein the construct is pRZ051, pRZ052, pRZ054.
39 . A silencing construct for modifying the expression of a target gene involved in recombination, which construct comprises suitable transcription initiation and termination sequences and a silencing DNA sequence having the nucleotide sequence of at least part of the promoter of the target gene or the complementary sequence thereof.
40 . The construct as claimed in claim 39 , wherein the silencing DNA sequence has a nucleotide sequence that is at least 50%, preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, most preferably at least 90% homologous to the promoter of the target gene.
41 . The construct as claimed in claim 40 , wherein the homology is determined over that part of the target gene that is essential for the biological function of the promoter.
42 . A set of primers selected from the group consisting of:
(SEQ ID NO: 9)
1.
5′ ACAGAGGCTTTTGGGGAATT 3′
and
reverse complement primer
(SEQ ID NO: 10)
5′ ACAGAGGCTTTTGGGGAATT 3′;
(SEQ ID NO: 13)
2.
5′ GTTTTTTATGGCTCATATTGGATGTTTYGTNCCNGC 3′
and
reverse complement primer
(SEQ ID NO: 14)
5′ TCCACAGTATTAGTTCCCTTTCCAWAYTCRTCDAT 3′
(SEQ ID NO: 15)
3.
TgTCCCGGCTGCATCGGCCAAAATCGGC 3′
and
reverse complement primer
(SEQ ID NO: 16)
5′ GAATTCGTCAATCAAAATCAGTGACCG 3′.
43 . A method for transferring cytoplasmic male sterility (CMS), comprising:
a) providing a heterozygous starting plant; b) allowing the starting plant to produce haploid cells; c) creating homozygous plant s from the haploid cells thus obtained; and d) selecting the plants having the desired set of chromosomes for CMS; characterized in that during production of the haploid cells no recombination occurs in order to obtain a limited number of genetically different haploid cells.
44 . A method for making parental lines for the production of F1 hybrid seed, comprising:
a) providing a heterozygous starting plant; b) allowing the starting plant to produce haploid cells; c) creating homozygous plants from the haploid cells thus obtained; and d) selecting the plants having the desired set of chromosomes for the production of F1 hybrid seed; characterized in that during production of the haploid cells no recombination occurs in order to obtain a limited number of genetically different haploid cells.
45 . F1 hybrid seeds obtainable by crossing plants having the desired set of chromosomes as produced by the method as claimed of claim 1 .
46 . Seed, the embryo of which has the same genetic constitution as the starting plant as defined in claim 1 and the seed coat of which has a genetic constitution that is the same as the genetic constitution of the seed coat of the seed that produced the starting plant.Cited by (0)
No later patents cite this yet.
References (0)
No backward citations on record.