Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity

Abstract

The application is related to compositions and methods for the treatment of hypersensitivity, wherein the compositions comprise a particle packaged with immunostimulatory nucleic acids. The compositions of the invention are particularly useful in the treatment of atopic eczema, asthma and IgE-mediated allergy (type I allergy), especially pollen allergy and house dust allergy.

1 . A method of treating hypersensitivity in an animal, wherein said hypersensitivity is allergy or asthma, wherein said method comprises introducing a composition into said animal, and wherein said composition comprises:
 (a) a virus-like particle of an RNA bacteriophage; and   (b) an unmethylated CpG-containing oligonucleotide;   wherein said virus-like particle of an RNA bacteriophage is packaged with said unmethylated CpG-containing oligonucleotide, and wherein said method does not comprise co-administering an allergen to said animal, and wherein introduction of said composition treats said hypersensitivity in said animal.   
     
     
         2 - 6 . (canceled) 
     
     
         7 . The method of  claim 1 , wherein said virus-like particle of an RNA bacteriophage comprises coat proteins, or fragments thereof, of an RNA bacteriophage. 
     
     
         8 . The method of  claim 1 , wherein said RNA bacteriophage is selected from the group consisting of:
 (a) bacteriophage Qβ;   (b) bacteriophage R17;   (c) bacteriophage fr;   (d) bacteriophage GA;   (e) bacteriophage SP;   (f) bacteriophage MS2;   (g) bacteriophage M11;   (h) bacteriophage MX1;   (i) bacteriophage NL95;   (j) bacteriophage f2;   (k) bacteriophage PP7; and   (l) bacteriophage AP205.   
     
     
         9 - 19 . (canceled) 
     
     
         20 . The method of  claim 1 , wherein said unmethylated CpG containing oligonucleotide is capable of stimulating IFN-alpha production in a cell. 
     
     
         21 - 24 . (canceled) 
     
     
         25 . The method of  claim 1 , wherein said unmethylated CpG-containing oligonucleotide comprises a palindromic sequence. 
     
     
         26 . The method of  claim 1 , wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence. 
     
     
         27 . The method of  claim 26 , wherein said palindromic sequence is GACGATCGTC (SEQ ID NO:28). 
     
     
         28 . The method of  claim 25 , wherein said palindromic sequence is flanked at its 5′-terminus and at its 3′-terminus by guanosine entities. 
     
     
         29 . The method of  claim 25 , wherein said palindromic sequence is flanked at its 5′-terminus by at least 3 and at most 15 guanosine entities, and wherein said palindromic sequence is flanked at its 3′-terminus by at least 3 and at most 15 guanosine entities. 
     
     
         30 . The method of  claim 1 , wherein said unmethylated CpG-containing oligonucleotide comprises the sequence selected from the group consisting of: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 32) 
                 
                     
                   (a) “G6-6” GGGGGGGACGATCGTCGGGGGG; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 33) 
                 
                     
                   (b) “G7-7” GGGGGGGGACGATCGTCGGGGGGG;  
                 
                     
                     
                 
                     
                   (SEQ ID NO: 25) 
                 
                     
                   (c) “G8-8” GGGGGGGGGACGATCGTCGGGGGGGG; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 26) 
                 
                     
                   (d) “G9-9” GGGGGGGGGGACGATCGTCGGGGGGGGG; 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 27) 
                 
                     
                   (e) “G10” GGGGGGGGGGGACGATCGTCGGGGGGGGGG. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         31 . The method of  claim 1 , wherein said unmethylated CpG-containing oligonucleotide comprises the sequence 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 27) 
                 
                     
                   GGGGGGGGGG GACGATCGTC GGGGGGGGGG.  
                 
             
                
                
               
            
           
         
       
     
     
         32 . The method of  claim 1 , wherein said unmethylated CpG-containing oligonucleotide consists exclusively of phosphodiester bound nucleotides. 
     
     
         33 - 39 . (canceled) 
     
     
         40 . The method of  claim 1 , wherein said hypersensitivity is asthma. 
     
     
         41 . The method of  claim 40 , wherein said asthma is IgE-mediated asthma. 
     
     
         42 - 53 . (canceled) 
     
     
         54 . The method of  claim 1 , wherein said animal is a human. 
     
     
         55 . (canceled) 
     
     
         56 . (canceled) 
     
     
         57 . The method of  claim 1 , wherein said method does not comprise introducing to said animal. 
     
     
         58 . (canceled) 
     
     
         59 . (canceled) 
     
     
         60 . The method of  claim 1  wherein an allergen is not introduced in said animal for at least one week before and at least one week after said introduction of said composition in said animal. 
     
     
         61 . (canceled) 
     
     
         62 . The method of  claim 1 , wherein an allergen is not introduced in said animal for at least eight weeks before and at least eights weeks after said introduction of said composition in said animal. 
     
     
         63 - 79 . (canceled) 
     
     
         80 . The method of  claim 1 , wherein said virus-like particle of an RNA bacteriophage essentially consists of coat proteins having the amino acid sequence of SEQ ID NO:3. 
     
     
         81 . The method of  claim 1 , wherein said composition does not comprise an allergen.