US2014105873A1PendingUtilityA1

Agents useful in treating facioscapulohumeral muscular dystrophy

Assignee: UNIV MONSPriority: Sep 2, 2010Filed: Nov 12, 2013Published: Apr 17, 2014
Est. expirySep 2, 2030(~4.1 yrs left)· nominal 20-yr term from priority
C12N 15/111C12N 2310/3233C12N 2310/321C12N 2310/11C12N 15/113A61P 35/00C12N 2310/315C12N 2320/33C12N 2310/14C12N 2310/3513C12N 2310/531
62
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The invention teaches antisense agents and RNA interference agents useful for treating diseases and conditions the treatment of which can benefit from reducing the expression of double homeobox 4 and/or double homeobox 4c, more particularly facioscapulohumeral muscular dystrophy. Further elaborated are methods, uses and further products employing such agents.

Claims

exact text as granted — not AI-modified
What is claimed is: 
     
         1 . A method for treating a disease or condition the treatment of which can benefit from reducing the expression of double homeobox 4 and/or double homeobox 4c in a subject, comprising administering to said subject a therapeutically or prophylactically effective amount of one or more agents selected from the group consisting of:
 an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes;   a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes;   a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes;   a host cell or a progeny thereof comprising
 an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, 
 a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or 
 a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes; 
   a host organism or a progeny thereof comprising
 an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, 
 a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, 
 a recombinant nucleic acid construct or vector comprising a nucleic acid 
 encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or 
 a host cell or a progeny thereof comprising
 an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, 
 a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or 
 a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes; or 
 
   a composition or formulation comprising
 an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, 
 a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, 
 a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, 
 a host cell or a progeny thereof comprising
 an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, 
 a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or 
 a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or 
 
 a host organism or a progeny thereof comprising
 an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, 
 a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, 
 a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or 
 a host cell or a progeny thereof comprising
 an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, 
 a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or 
 a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes. 
 
 
   
     
     
         2 . The method according to  claim 1 , wherein the disease or condition is facioscapulohumeral muscular dystrophy (FSHD). 
     
     
         3 . The method according to  claim 1 , wherein the disease or condition is a sarcoma comprising expression of a fusion protein between DUX4 or DUX4c and another, unrelated protein. 
     
     
         4 . The method according to  claim 1 , wherein the antisense agent is capable of binding to the DUX4 gene but not to the DUX4c gene. 
     
     
         5 . The method according to  claim 1 , wherein the antisense agent is capable of binding to the DUX4c gene but not to the DUX4 gene. 
     
     
         6 . The method according to  claim 1 , wherein the antisense agent is an antisense molecule. 
     
     
         7 . The method according to  claim 6 , wherein the antisense molecule is an antisense nucleic acid molecule, an antisense nucleic acid analogue molecule, an antisense oligonucleotide or an antisense oligonucleotide analogue. 
     
     
         8 . The method according to  claim 1 , wherein the antisense agent is between about 10 and about 100, between about 12 and about 80, between about 15 and about 50, between about 20 and about 40, or between about 20 and about 30 nucleotides or nucleotide analogues in length. 
     
     
         9 . The method according to  claim 1 , wherein the antisense agent is an antisense oligonucleotide analogue comprising a 2′-O-methylated phosphorothioate backbone or a phosphorodiamidate morpholino backbone. 
     
     
         10 . The method according to  claim 1 , wherein the antisense agent is conjugated to a cell penetrating peptide (CPP). 
     
     
         11 . The method according to  claim 1 , wherein the antisense agent is capable of binding to a sequence element required for splicing of the DUX4 or DUX4c genes. 
     
     
         12 . The method according to  claim 11 , wherein the antisense agent is capable of binding to a sequence element required for splicing of the DUX4 gene, but not required for splicing of the DUX4c gene. 
     
     
         13 . The method according to  claim 11 , wherein the antisense agent is capable of binding to a sequence element required for splicing of the DUX4c gene, but not required for splicing of the DUX4 gene. 
     
     
         14 . The method according to  claim 11 , wherein the sequence element required for splicing of the DUX4 or DUX4c genes is selected from the group consisting of splice donor sites, splice acceptor sites, pyrimidine-rich or polypyrimidine tracts upstream of splice acceptor sites, exon-intron boundaries, intron-exon boundaries, branch sites and exonic splicing enhancer elements of the DUX4 or DUX4c genes. 
     
     
         15 . The method according to  claim 14 , wherein the sequence element required for splicing of the DUX4 or DUX4c genes is selected from the group consisting of splice donor sites, splice acceptor sites, exon-intron boundaries and intron-exon boundaries of the DUX4 or DUX4c genes. 
     
     
         16 . The method according to  claim 1 , wherein the antisense agent is configured to bind to at least about 10 bases, at least about 15 bases, at least about 20 bases, at least about 25 bases, at least about 30 bases, between about 10 and about 40 bases, or between about 20 and about 30 bases of any one of the following DUX4 sequences (SEQ ID NO: 2, 4, 6, 8) or of variants thereof having at least about 80%, at least about 90% or at least about 95% sequence identity to the respective sequences: 
       
         
           
                 
                 
               
                   (SEQ ID NO: 2) 
                     
                 
                   ggctctgctggaggagctttaggacgcggggttgggacggggtcgggtggttcggggcag; 
                     
                 
                     
                 
                   (SEQ ID NO: 4) 
                     
                 
                   gctgaccggcctgggattcctgccttctaggtctaggcccggtgagagactccacaccgc; 
                     
                 
                     
                 
                   (SEQ ID NO: 6) 
                     
                 
                   ggcatcccggggatcccagagccggcccaggtacctgcgcacgcgcgggtttgcgggcag; 
                     
                 
                   or 
                 
                     
                 
                   (SEQ ID NO: 8) 
                     
                 
                   tctgtctgtctttgcccgcttcctggctagacctgcgcgcagtgcgcaccccggctgacg. 
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         17 . The method according to  claim 1 , wherein the antisense agent comprises a sequence complementary to any one of the following DUX4 sequences (SEQ ID NO: 10 to 15, 66) or to variants thereof having at least about 80%, at least about 90% or at least about 95% sequence identity to the respective sequences, or to fragments thereof comprising at least about 10 bases, at least about 12 bases, at least about 15 bases, at least about 20 bases, or at least about 25 bases of the respective sequences or variants of: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 10) 
                 
                     
                   cttctaggtctaggcccggtgagag; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 11) 
                 
                     
                   tggctagacctgcgcgcagtgcgca; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 12) 
                 
                     
                   cttcctggctagacctgcgcgcagt; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 13) 
                 
                     
                   agacctgcgcgcagtgcgcaccccg; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 14) 
                 
                     
                   cttcctggctagacctgcgcgcagtgcgca; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 15) 
                 
                     
                   gcccgcttcctggctagacctgcgcgcagt; 
                 
                     
                   or 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 66) 
                 
                     
                   acgcggg gttgggacggggtcgggt . 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         18 . The method according to  claim 1 , wherein the antisense agent is an anti-DUX4 antisense agent comprising any one of sequences (SEQ ID NO: 16 to 21, 64) or variants thereof having at least about 80%, at least about 90% or at least about 95% sequence identity to the respective sequences, or fragments thereof comprising at least about 10 bases, at least about 12 bases, at least about 15 bases, at least about 20 bases, or at least about 25 bases, of the respective sequences or variants: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 16) 
                 
                     
                   CUCUCACCGGGCCUAGACCUAGAAG; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 17) 
                 
                     
                   UGCGCACUGCGCGCAGGUCUAGCCA; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 18) 
                 
                     
                   ACUGCGCGCAGGUCUAGCCAGGAAG; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 19) 
                 
                     
                   CGGGGUGCGCACUGCGCGCAGGUCU; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 20) 
                 
                     
                   UGCGCACUGCGCGCAGGUCUAGCCAGGAAG; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 21) 
                 
                     
                   ACUGCGCGCAGGUCUAGCCAGGAAGCGGGC; 
                 
                     
                   or 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 64) 
                 
                     
                   ACCCGACCCCGUCCCAACCCCGCGU. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         19 . The method according to  claim 1 , wherein the antisense agent is capable of binding to a sequence element required for polyadenylation of the DUX4 gene. 
     
     
         20 . The method according to  claim 19 , wherein the antisense agent is capable of binding to a sequence element required for polyadenylation of the DUX4 gene but not required for polyadenylation of the DUX4c gene. 
     
     
         21 . The method according to  claim 19 , wherein the sequence element required for polyadenylation of the DUX4 gene is a polyadenylation signal of the DUX4 gene. 
     
     
         22 . The method according to  claim 1 , wherein the antisense agent is configured to bind to at least about 10 bases, at least about 15 bases, at least about 20 bases, at least about 25 bases, at least about 30 bases, between about 10 and about 40 consecutive bases, or between about 20 and about 30 consecutive bases, of the following DUX4 sequences (SEQ ID NO: 67) or variants thereof having at least about 80%, at least about 90% or at least about 95% sequence identity to said sequence: 
       
         
           
                 
                 
               
                   (SEQ ID NO: 67) 
                     
                 
                   acatctcctggatgattagttcagagatat attaaa atgccccctccctgtggatcctatagaaga. 
                     
                 
             
                
                
               
            
           
         
       
     
     
         23 . The method according to  claim 1 , wherein the antisense agent comprises a sequence complementary to the following DUX4 sequences (SEQ ID NO: 69) or to variants thereof having at least about 80%, at least about 90%, or at least about 95% sequence identity to said sequence, or to fragments thereof comprising at least 10 bases, or at least 12 bases, at least about 15 bases, at least about 20 bases, or at least about 25 bases of the said sequences or variants: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 69) 
                 
                     
                   agttcagagatat attaaa atgccc. 
                 
             
                
                
               
            
           
         
       
     
     
         24 . The method according to  claim 1 , where the antisense agent is anti-DUX4 and comprises the sequence (SEQ ID NO: 65) or variants thereof having at least about 80%, at least about 90%, or at least about 95% sequence identity to said sequence, or fragments thereof comprising at least about 10 bases, at least about 12 bases, at least about 15 bases, at least about 20 bases, or at least about 25 bases of said sequence or variants: 
       
         
           
                 
                 
                 
               
                     
                   GGGCAUUUUAAUAUAUCUCUGAACU. 
                   (SEQ ID NO: 65) 
                 
             
                
               
            
           
         
       
     
     
         25 . The method according to  claim 1 , wherein the composition or formulation is a pharmaceutical composition further comprising one or more pharmaceutically acceptable carriers. 
     
     
         26 . The method according to  claim 1 , wherein the host cell is a myoblast or a myoblast precursor derived from the subject.

Join the waitlist — get patent alerts

Track US2014105873A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.