US2014200338A1PendingUtilityA1
Oligonucleotides containing high concentrations of guanine monomers
Est. expiryDec 12, 2026(~0.4 yrs left)· nominal 20-yr term from priority
Inventors:Brian Sproat
C07H 21/02C07H 1/06C07H 21/00C07H 1/00A61P 37/02
58
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
This invention pertains to methods for oligonucleotide synthesis, specifically the synthesis of oligonucleotides that contain a high content of guanine monomers. In more detail, the invention relates to a method for coupling a nucleoside phosphoramidite during the synthesis of an oligonucleotide to a universal support, to a first nucleoside, or to an extending oligonucleotide. The invention further relates to oligonucleotides obtainable by the methods of the invention.
Claims
exact text as granted — not AI-modified1 . A method for coupling a nucleoside phosphoramidite during the synthesis of an oligonucleotide to a universal support, to a first nucleoside, or to an extending oligonucleotide, said method comprising the step of:
(i) generating a coupling solution, wherein said coupling solution comprises:
(a) at least one first solvent, wherein said at least one first solvent is a polar aprotic solvent, and wherein said at least one first solvent is not acetonitrile;
(b) an activating reagent; and
(c) said nucleoside phosphoramidite;
wherein the concentration of said nucleoside phosphoramidite in said coupling solution is at least 0.03 M; and (ii) contacting said coupling solution with said universal support, with said first nucleoside, or with said extending oligonucleotide.
2 . The method of claim 1 , wherein said at least one first solvent is selected from the group consisting of:
(a) sulfolane; (b) 1-methylpyrrolidin-2-one; (c) N,N-dimethylacetamide; (d) tetramethylurea; and (e) dimethylsulfoxide (DMSO).
3 . (canceled)
4 . The method of claim 1 , wherein the concentration of said nucleoside phosphoramidite in said coupling solution is 0.03 to 0.30 M.
5 - 7 . (canceled)
8 . The method of any one of claim 6 , wherein the ratio (v/v) of said at least one first solvent to said second solvent is between 5:1 and 1:2.
9 . The method of any one of claim 6 , wherein the ratio (v/v) of said at least one first solvent to said second solvent is 1:1.
10 . The method of claim 1 , wherein said first nucleoside and/or said extending oligonucleotide is immobilized on a support.
11 . The method of claim 1 , wherein said support is a polystyrene support, wherein said polystyrene support is cross linked by divinylbenzene.
12 . The method of claim 1 , wherein said oligonucleotide comprises at least 30% guanine monomers.
13 - 15 . (canceled)
16 . The method of claim 1 , wherein said oligonucleotide comprises a first region of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive guanine monomers.
17 . The method of claim 16 , wherein said oligonucleotide comprises a second region of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive guanine monomers.
18 . The method of any one of claim 17 , wherein said first region is located at the 3′-terminus of said oligonucleotide and/or wherein said second region is located at the 5′-terminus of said oligonucleotide.
19 . The method of claim 1 , wherein said oligonucleotide comprises 10 to 50 nucleotide monomers.
20 . (canceled)
21 . (canceled)
22 . The method of claim 1 , wherein said oligonucleotide comprises a nucleotide sequence selected from the group consisting of:
(SEQ ID NO: 3)
(a) GGGGACGATCGTCGGGGGG;
(SEQ ID NO: 4)
(b) GGGGGACGATCGTCGGGGGG;
(SEQ ID NO: 5)
(c) GGGGGGACGATCGTCGGGGGG;
(SEQ ID NO: 6)
(d) GGGGGGGACGATCGTCGGGGGG;
(SEQ ID NO: 7)
(e) GGGGGGGGACGATCGTCGGGGGGG;
(SEQ ID NO: 8)
(f) GGGGGGGGGACGATCGTCGGGGGGGG;
(SEQ ID NO: 9)
(g) GGGGGGGGGGACGATCGTCGGGGGGGGG;
(SEQ ID NO: 10)
(h) GGGGGGGGGGGACGATCGTCGGGGGGGGGG;
and
(SEQ ID NO: 11)
(i) GGGGGGCGACGACGATCGTCGTCGGGGGGG;
23 . A method for producing an oligonucleotide, said method comprising the method of claim 1 .
24 . A method for producing oligonucleotide, said method comprising
(i) coupling a nucleoside phosphoramidite to a first nucleoside; wherein said coupling comprises the method of claim 1 ; (ii) generating an extending oligonucleotide by oxidizing the product of step (i); (iii) coupling a nucleoside phosphoramidite to the product of step (ii) after deprotection; wherein said coupling comprises the method of claim 1 ; (iv) generating an extending oligonucleotide by oxidizing the product of step (iii); and (v) repeating steps (iii) and (iv) unto said extending oligonucleotide comprises the sequence of said oligonucleotide.
25 . The method of claim 24 , wherein said method further comprises the step of purifying said oligonucleotide under denaturing conditions, wherein said denaturing conditions are characterized by a pH of 10 to 14.
26 . The method of claim 25 , wherein said purifying is performed by anion-exchange chromatography.
27 . The method of any one of claim 24 , wherein said oligonucleotide is produced in a molar yield with respect to said first nucleoside of at least 20%.
28 . The method of claim 1 , wherein the purity of said oligonucleotide is at least 75%.
29 . The method of claim 28 , wherein said oligonucleotide comprises a nucleotide sequence selected from the group consisting of:
(SEQ ID NO: 3)
(a) GGGGACGATCGTCGGGGGG;
(SEQ ID NO: 4)
(b) GGGGGACGATCGTCGGGGGG;
(SEQ ID NO: 5)
(c) GGGGGGACGATCGTCGGGGGG;
(SEQ ID NO: 6)
(d) GGGGGGGACGATCGTCGGGGGG;
(SEQ ID NO: 7)
(e) GGGGGGGGACGATCGTCGGGGGGG;
(SEQ ID NO: 8)
(f) GGGGGGGGGACGATCGTCGGGGGGGG;
(SEQ ID NO: 9)
(g) GGGGGGGGGGACGATCGTCGGGGGGGGG;
(SEQ ID NO: 10)
(h) GGGGGGGGGGGACGATCGTCGGGGGGGGGG;
and
(SEQ ID NO: 11)
(i) GGGGGGGCGACGACGATCGTCGTCGGGGGGG.
30 . (canceled)Join the waitlist — get patent alerts
Track US2014200338A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.