Molecular targets for healing or treating wounds

Abstract

The invention relates to at least one molecular target for healing or treating wounds and, in particular chronic, human wounds. The molecular target is PTPRK, or a protein 50% homologous therewith, and which retains the same activity as PTPRK protein. Further, the invention concerns a novel therapeutic for treating said wounds and a novel gene therapy approach, involving said molecular target, for treating said wounds.

1 . A therapeutic comprising an inhibitor of one or both of PTPRK gene expression or PTPRK protein activity or an inhibitor of a protein that is at least 50% homologous to PTPRK for use in the treatment of wounds. 
     
     
         2 . The therapeutic according to  claim 1  wherein said inhibitor is an inhibitor of PTPRK gene expression. 
     
     
         3 . The therapeutic according to  claim 2  wherein said inhibitor is selected from the group consisting of: anti-sense DNA or RNA, siRNA, or ribozymes, either naked or in the form of plasmid or viral vectors. 
     
     
         4 . The therapeutic according to  claim 3  wherein said inhibitor is anti-PTPRK ribozyme/RNA transgene selected from the group comprising:
 transgene 1 5′Ctgcagagtgagttacacagcctgatgagtccgtgaggacgaaa tacaaatcctggtcagtttttgtt actagt′3 SEQ ID NO: 7; 
 transgene 2 5′Ctgcaggatgataggaccatcgccaatctgatgagtccgtgaggacgaaa tcgagttggcatttagttggatcactagt′3 SEQ ID NO: 8; and 
 transgene 3 Ctgcagtttgctcttttttacaattaatatctgatgagtccgtgaggacgaaa caactaggagaaggaggatgaactagt′3 SEQ ID NO: 9. 
 
     
     
         5 . The therapeutic according to  claim 1  wherein said inhibitor is an inhibitor of PTPRK protein function. 
     
     
         6 . The therapeutic according to  claim 5  wherein said inhibitor is selected from the group consisting of: a PTPRK binding agent that binds, either reversibly or irreversibly, to inhibit protein function such as an antibody or a known, or synthesized, PTPRK antagonist; or an agent that works upstream or downstream of the PTPRK signalling mechanism to inhibit PTPRK function. 
     
     
         7 . The therapeutic according to  claim 6  wherein said inhibitor is Stibogluconate, or a salt thereof, or Pentostam™ (GlaxoSmithKline). 
     
     
         8 . The therapeutic according to  claim 1  wherein the therapeutic is formulated for use in treating mammalian wounds. 
     
     
         9 . The therapeutic according to  claim 1  wherein the therapeutic is formulated for use in treating chronic wounds comprising venous ulcers, diabetic ulcers, and pressure ulcers 
     
     
         10 . The therapeutic according to  claim 1  wherein the therapeutic is formulated for use in treating human wounds. 
     
     
         11 . The therapeutic according to  claim 1  wherein the therapeutic is formulated for topical application. 
     
     
         12 . The therapeutic according to  claim 1  wherein the therapeutic is formulated for application to a dressing or impregnation in a dressing. 
     
     
         13 . A pharmaceutical composition comprising a therapeutic according to  claim 1  together with a pharmaceutically acceptable carrier. 
     
     
         14 . A method for preparing a pharmaceutical composition according to  claim 13  comprising bringing said therapeutic in conjunction or association with a pharmaceutically or veterinarily acceptable carrier or vehicle. 
     
     
         15 . A method for treating a mammalian wound which method comprises:
 administering to said wound a therapeutic that inhibits one or both of PTPRK gene expression or PTPRK protein activity.   
     
     
         16 . A kit for treating a wound wherein said kit comprises:
 (a) at least one therapeutic according to  claim 1 ; and   (b) at least one dressing for applying to said wound.   
     
     
         17 . A combination therapeutic for treating a wound comprising an inhibitor of PTPRK gene expression and an inhibitor of PTPRK protein activity. 
     
     
         18 . A combination therapeutic for treating a wound comprising:
 a) either an inhibitor of PTPRK gene expression or an inhibitor of PTPRK protein activity; and   b) at least one further therapeutic.   
     
     
         19 . (canceled) 
     
     
         20 . A kit for treating a wound wherein said kit comprises:
 (a) a composition according to  claim 13 ; and   (b) at least one dressing for applying to said wound.