Compositions and methods for modulating angiogenesis

Abstract

The invention generally features compositions and methods that are useful for modulating angiogenesis.

1 - 17 . (canceled) 
     
     
         18 . A method for increasing the expression of a TSR protein in a cell, the method comprising contacting the cell with an effective amount of an inhibitory nucleic acid molecule complementary to at least a portion of a microRNA nucleic acid molecule of the mir-17-92 cluster, thereby increasing the expression of a TSR protein. 
     
     
         19 . The method of  claim 18 , wherein the contact increases expression of a thrombospondin type 1 repeat (TSR) protein. 
     
     
         20 . The method of  claim 18 , wherein the method increases expression of Tsp1 or CTGF relative to a reference. 
     
     
         21 . The method of  claim 20 , wherein the reference is the level of Tsp 1 or CTGF expression in the cell prior to treatment or the level present in a corresponding neoplastic control cell. 
     
     
         22 . The method of  claim 18 , wherein the inhibitory nucleic acid molecule is an antisense and siRNA nucleic acid molecule. 
     
     
         23 . The method of  claim 18 , wherein the antisense nucleic acid molecule comprises a nucleobase sequence having at least 95% identity to a sequence selected from the group consisting of: 
       
         
           
                 
                 
               
                     
                   miR-17-5p: 
                 
                     
                   ACU ACCUGCACuGUAAGC ACUUUG; 
                 
                     
                     
                 
                     
                   mir-18a: 
                 
                     
                   UAUCUGCACUAGAUGCACCUUA; 
                 
                     
                     
                 
                     
                   mir-19a: 
                 
                     
                   UCAGUUUUGCAUAGAUUUGCACA; 
                 
                     
                     
                 
                     
                   mir-19b: 
                 
                     
                   UC AGUUUUGC AUGGAUUUGCACA; 
                 
                     
                     
                 
                     
                   mir-20a: 
                 
                     
                   CUACCUGCACUAUAAGCACUUUA; 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   mir-92-1: 
                 
                     
                   C AGGCCGGG AC AAGUGC AAUA. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         24 . The method of  claim 18 , wherein the cell is a neoplastic cell. 
     
     
         25 . The method of  claim 18 , wherein the cell is an ocular cell. 
     
     
         26 . A method of treating an apoptosis resistant neoplasm or chemo-resistant neoplasm in a subject, the method comprising:
 (a) identifying a subject as having an apoptosis resistant neoplasm; and   (b) administering to the subject an effective amount of an inhibitory nucleic acid molecule complementary to at least a portion of a microRNA of the mir-17-92 cluster.   
     
     
         27 . A method of treating or preventing a neoplasm in a subject in need thereof, the method comprising:
 (a) identifying a neoplasm having an increase in the expression of a TSR protein; and   (b) administering to the subject an effective amount of an inhibitory nucleic acid molecule complementary to at least a portion of a microRNA of the mir-17-92 cluster.   
     
     
         28 . A method of treating an ocular disease characterized by increased angiogenesis in a subject, the method comprising administering to the subject an effective amount of an inhibitory nucleic acid molecule complementary to at least a portion of a microRNA of the mir-17-92 cluster. 
     
     
         29 - 40 . (canceled) 
     
     
         41 . A method of characterizing a neoplasia as amenable to treatment with the method of  claim 27 , the method comprising assaying the expression of a microRNA encoded by the miR-17-92 cluster. 
     
     
         42 - 43 . (canceled) 
     
     
         44 . A method of selecting a treatment for a subject having a neoplasm, the method comprising
 (a) detecting an increase the expression of a microRNA encoded by a mir-17-92 cluster or a TSR protein; and   (b) identifying the patient as having a neoplasm amenable to treatment with an inhibitory nucleic acid molecule that reduces the expression of a microRNA of the miR-17-92 cluster.   
     
     
         45 . The method of  claim 44 , wherein the method detects an increase in the expression of a microRNA and a TSR protein. 
     
     
         46 . A method of monitoring the treatment of a subject having a neoplasia, the method comprising:
 (a) assaying the expression of a TSR protein in a cell of the subject; and   (b) detecting an increase or a decrease in the expression of a TSR protein relative to a reference.   
     
     
         47 . (canceled) 
     
     
         48 . An isolated nucleic acid molecule having at least 85% nucleic acid sequence identity to a microRNA encoded by the miR-17-92 cluster, wherein expression of the nucleic acid molecule in a cell enhances angiogenesis. 
     
     
         49 - 51 . (canceled) 
     
     
         52 . An expression vector encoding a nucleic acid molecule of  claim 48 . 
     
     
         53 - 54 . (canceled) 
     
     
         55 . A cell comprising a nucleic acid molecule of  claim 48 . 
     
     
         56 - 60 . (canceled) 
     
     
         61 . A method of identifying an agent that reduces angiogenesis, the method comprising
 (a) contacting a cell that expresses a TSR selected from the group consisting of: Connective tissue growth factor (CTGF), thrombospondin, type I domain containing 3 isoform 3 (THSD3), A disintegrin and metalloproteinase with Tsp motifs 18 (ADAMTS18), A disintegrin and metalloproteinase with Tsp motifs 12 (ADAMTS12), Thrombospondin 1 (THBS1), Thrombospondin, type 1 domain containing 1 (THSD1), A disintegrin and metalloproteinase with Tsp motifs 1 (ADAMTS1), A disintegrin and metalloproteinase with Tsp motifs 6 (ADAMTS6), WNT1 inducible signaling pathway protein 2 (WISP2), and Brain-specific angiogenesis inhibitor 3 (BAD) and a microRNA of the mir-17-92 cluster with a test agent; and   (b) detecting an increase in the level of TSR expression in the cell contacted by the agent with the level present in a control cell, wherein the increase in TSR expression identifying the agent as reducing angiogenesis.   
     
     
         62 . A method of identifying an agent that treats or prevents an apoptosis resistant neoplasm, the method comprising
 (a) contacting a cell that expresses a microRNA of the mir-17-92 cluster with an agent, and   (b) detecting a reduction in the level of microRNA expression in the cell contacted by the agent with the level of expression in a control cell, wherein an agent that decreases microRNA expression thereby treats or prevents a neoplasm.   
     
     
         63 - 64 . (canceled) 
     
     
         65 . A method for diagnosing a subject as having or having a propensity to develop an apoptosis resistant neoplasia, the method comprising
 (a) measuring the level of a TSR protein selected from the group consisting of: Connective tissue growth factor (CTGF), thrombospondin, type I domain containing 3 isoform 3 (THSD3), A disintegrin and metalloproteinase with Tsp motifs 18 (ADAMTS18), A disintegrin and metalloproteinase with Tsp motifs 12 (ADAMTS12), Thrombospondin 1 (THBS1), Thrombospondin, type 1 domain containing 1 (THSD1), A disintegrin and metalloproteinase with Tsp motifs 1 (ADAMTS1), A disintegrin and metalloproteinase with Tsp motifs 6 (ADAMTS6), WNT1 inducible signaling pathway protein 2 (WISP2), and Brain-specific angiogenesis inhibitor 3 (BAI3) in a biological sample from the subject; and   (b) comparing the level of the TSR protein in the subject to the level present in a control subject, wherein a reduced level of TSR protein indicates the subject has or has a propensity to develop an apoptosis resistant neoplasia.   
     
     
         66 . A method for diagnosing a subject as having or having a propensity to develop an apoptosis resistant neoplasia, the method comprising
 (a) measuring the level of a mir17-92 encoded microRNA in a biological sample derived from a subject; and   (b) detecting an increased level of the microRNA relative to the level present in a control sample, wherein a, wherein an increase in the level of the mir-17-92 encoded microRNA indicates the subject has or has a propensity to develop a an apoptosis resistant neoplasia.   
     
     
         67 - 68 . (canceled) 
     
     
         69 . A pharmaceutical composition for treating an apoptosis resistant neoplasm in a subject comprising an effective amount of an inhibitory nucleic acid molecule that is complementary to at least a fragment of mir-17-92 in a pharmaceutically acceptable excipient.