Design and construction of bifunctional short hairpin rna

Abstract

A method for designing a bi-shRNA expression cassette encoding a bi-shRNA comprising: selecting one or more target site sequences; providing a backbone sequence comprising a first and a second stem-loop structure, inserting a first passenger strand and a second passenger strand and providing for synthesis of the bi-shRNA expression cassette.

What is claimed is: 
     
         1 . A method for designing a bi-shRNA expression cassette encoding a bi-shRNA comprising:
 selecting one or more first target site sequences of a targeted species, wherein the one or more first target site sequences have low homology with other mRNAs of the targeted species, wherein low homology is selected from the group consisting of less then 75%, less then 80%, less then 90%, less then 95%, and less then 98% homology;   selecting one or more second target site sequences of a targeted species, wherein the one or more first target site sequences have low homology with other mRNAs of the targeted species, wherein low homology is selected from the group consisting of less then 75%, less then 80%, less then 90%, less then 95%, and less then 98% homology;   providing a backbone sequence comprising a first and a second stem-loop structure, wherein the first stem-loop structure comprises two first insertion sites linked by a first loop sequence within the first stem and wherein the second stem-loop structure comprises two second insertion sites linked by a second loop sequence within the second stem; wherein the first and the second stem-loop structures are linked by a sequence longer than 5 nucleotides;   inserting a first passenger strand and a first guide strand into the two first insertion sites to form the first stem, wherein the first passenger strand is homologous to the one or more first target site sequences and wherein the first guide strand is complementary to the first passenger strand, or wherein the first passenger strand is identical to the reverse orientation of the first guide strand; and   inserting a second passenger strand and a second guide strand into the two second insertion sites to form the second stem-loop structure, wherein either the second passenger strand or the second guide strand is homologous with the one or more first target site sequences, or wherein either the second passenger strand or the second guide strand is homologous with the one or more second target sites sequences, wherein the second passenger strand and the second guide strand are partially complementary, wherein partially complementary is defined has having 1, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 nucleotide mismatches when paired.   
     
     
         2 . The method of  claim 1 , wherein the bi-shRNA is defined as further comprising at least one of: the first stem-loop structure and the second stem-loop structure each comprise a loop of 6-15 nucleotides in size; the first stem-loop structure and the second stem-loop structure are each 40 to 100 nucleotides long; the first stem-loop structure and the second stem-loop structure are each 50 to 75 nucleotides long; the first stem-loop structure and the second stem-loop structure each comprise a stem of 19-45 nucleotides in size; or the first stem-loop structure and the second stem-loop structure each comprise a stem of 20-30 nucleotides in size. 
     
     
         3 . The method of  claim 1 , wherein at least one passenger strand and one guide strand are 16-19 nucleotides long, or at least one passenger strand and one guide strand are 19-22 nucleotides long. 
     
     
         4 . The method of  claim 1 , wherein the first loop and the second loop are identical; the first loop encodes the sequence AGUGAAGCCACAGAUGU (SEQ ID NO.:1); the second loop encodes the sequence AGUGAAGCCACAGAUGU (SEQ ID NO.:2). 
     
     
         5 . The method of  claim 1 , wherein the backbone sequence comprises the following sequence upstream of the first passenger strand and within the first stem: UUGACAGUGAGCGCC (SEQ ID NO.:3); and wherein the backbone sequence comprises the following sequence downstream of the first guide strand and within the first stem: GUUGCCUACUGCCUCGG (SEQ ID NO.:4). 
     
     
         6 . The method of  claim 1 , wherein the backbone sequence comprises the following sequence upstream of the second passenger strand and within the second stem: GCUGUUGACAGUGAGCGCC (SEQ ID NO.:5); and wherein the backbone sequence comprises the following sequence downstream of the second guide strand and within the second stem: GUUGCCUACUGCCUCGGAAGC (SEQ ID NO.:6). 
     
     
         7 . The method of  claim 1 , wherein the one or more nucleotide mismatches are located at nucleotide position 9, 10, and 11. 
     
     
         8 . The method of  claim 1 , further comprising determining a ΔG free energy of the second stem loop structure and introducing additional mismatches at the 3′ half of the second passenger strand if ΔG free energy is beyond about −10 Kcal·mole-1. 
     
     
         9 . The method of  claim 1 , wherein the bi-shRNA expression cassette further comprises a lead transcript upstream of the stem-loop structures, wherein the lead transcript is characterized in that it is at least 30 nucleotides or longer in lengths and does not interfere with transcription of the bi-shRNA expression cassette. 
     
     
         10 . The method of  claim 1 , further comprising the steps of: designing at least three bi-shRNA expression cassettes for the same gene; and comparing knockdown efficiency of the at least three bi-shRNA expression cassettes by in vitro assessment. 
     
     
         11 . The method of  claim 1 , further comprising operably linking the bi-shRNA expression cassette to a promoter, wherein the second stem-loop structure is upstream in relation to the first stem loop structure, or wherein the first stem-loop structure is upstream in relation to the second stem loop structure. 
     
     
         12 . The method of  claim 1 , further comprising integrating the bi-shRNA expression cassette into genomic DNA, wherein the genomic DNA is selected from the group comprising animal DNA, insect DNA, plant DNA, algae DNA, fungus DNA, yeast DNA, bacteria DNA, and human DNA. 
     
     
         13 . The method of  claim 1 , further comprising inserting the bi-shRNA expression cassette into an expression vector. 
     
     
         14 . The method of  claim 13 , wherein the expression vector comprises a 5′UTR and an intron. 
     
     
         15 . The method of  claim 13 , wherein the expression vector comprises a RNA polymerase II promoter operably linked to the expression of the bi-shRNA expression cassette. 
     
     
         16 . The method of  claim 1 , wherein the backbone sequence comprises a miR30a backbone sequence. 
     
     
         17 . The method of  claim 1 , wherein selecting one or more target site sequences comprises searching by BLAST to find target sites with lowest homology hits to other mRNA of the targeted species. 
     
     
         18 . The method of  claim 1 , wherein providing for synthesis is selected from the group comprising assembling multiple overlapping DNA oligonucleotides, synthesizing a polynucleotide, and combinations thereof. 
     
     
         19 . The method of  claim 1 , wherein providing for synthesis comprises designing DNA oligonucleotides from both strands having an overlap, wherein the overlap is at least four nucleotides. 
     
     
         20 . The method of  claim 1 , further comprising preparing a DNA-DOTAP:Chol Lipoplex. 
     
     
         21 . The method of  claim 1 , wherein the one or more first target site sequences are identical to the second one or more target site sequences. 
     
     
         22 . The method of  claim 1 , wherein the one or more first target site sequences and the one or more second target site sequence are not identical and located on a same transcript of the targeted species. 
     
     
         23 . The method of  claim 1 , wherein the one or more first target site sequences and the one or more second target site sequence are not identical and located within the same gene of the targeted species. 
     
     
         24 . The method of  claim 1 , wherein the bi-shRNA expression cassette is capable of integration into genomic DNA. 
     
     
         25 . The method of  claim 1 , further comprising integrating the bi-shRNA expression cassette into a crop genomic DNA, wherein crop is a non-animal species or variety that is grown to be harvested as food, livestock fodder, fuel or for any other economic purpose. 
     
     
         26 . The method of  claim 1 , further comprising the step of providing for synthesis of the bi-shRNA expression cassette. 
     
     
         27 . The method of  claim 1 , wherein the targeted species comprises a human, a plant, or an animal nucleic acid sequence. 
     
     
         28 . A bifunctional shRNA made by the method of  claim 1 . 
     
     
         29 . A nucleic acid sequence, which may comprise a single contiguous sequence or multiple distinct sequences that, individually or collectively, encode two or more RNA molecules, wherein: (a) a first RNA molecule comprises a first double stranded sequence, which comprises a first guide strand sequence that is complementary to a portion of an mRNA transcript encoded by the target gene; and (b) a second RNA molecule comprises a second double stranded sequence, which comprises a second guide strand sequence that is partially complementary to a portion of the mRNA transcript encoded by the target gene, wherein the second guide strand sequence comprises one or more bases that are mismatched with a nucleic acid sequence of the mRNA transcript encoded by the target gene. 
     
     
         30 . A biological material harboring the nucleic acid sequence of  claim 29 , wherein said material is selected from the group consisting of cells and viral vectors. 
     
     
         31 . A nucleic acid sequence, which may comprise a single contiguous sequence or multiple distinct sequences that, individually or collectively, encode two or more RNA molecules, wherein: (a) a first RNA molecule comprises a first double stranded sequence, which comprises a first guide strand sequence that is complementary to a portion of an mRNA transcript encoded by the target gene; and (b) a second RNA molecule comprises a second double stranded sequence, which comprises a second guide strand sequence that is partially complementary to a portion of the mRNA transcript encoded by the target gene, wherein the second guide strand sequence comprises one or more bases that are mismatched with the nucleic acid sequence of the mRNA transcript encoded by the target gene, wherein: (i) the first and second double stranded sequences reside within a stem portion of a stem loop structure, wherein the stem portion comprises about 19-45 nucleotides, a loop portion of the stem loop structure comprises about 4-25 nucleotides, and the stem portion comprises a nucleic acid sequence that is substantially similar to a sequence of a naturally occurring miRNA molecule; (ii) the first double stranded sequence comprises a sequence that is presented to a cleavage dependent pathway and is capable of binding to the mRNA transcript encoded by the target gene, which causes degradation of the mRNA transcript; and (iii) the second double stranded sequence comprises a sequence that is presented to a cleavage independent pathway and is capable of sequestering the mRNA transcript encoded by the target gene and repressing the translation thereof. 
     
     
         32 . A method for reducing the expression level of a target gene, which comprises providing a cell with one or more precursor nucleic acid sequences that encode two or more RNA molecules, wherein: (a) a first RNA molecule comprises a first double stranded sequence, which comprises a first guide strand sequence that is complementary to a portion of an mRNA transcript encoded by the target gene; and (b) a second RNA molecule comprises a second double stranded sequence, which comprises a second guide strand sequence that is partially complementary to a portion of the mRNA transcript encoded by the target gene, wherein the second guide strand sequence comprises one or more bases that are mismatched with the nucleic acid sequence of the mRNA transcript encoded by the target gene, wherein: (i) the first and second double stranded sequences reside within a stem portion of a stem loop structure, wherein the stem portion comprises about 19-45 nucleotides, a loop portion of the stem loop structure comprises about 4-25 nucleotides, and the stem portion comprises a nucleic acid sequence that is substantially similar to a sequence of a naturally occurring miRNA molecule; (ii) the first double stranded sequence comprises a sequence that is presented to a cleavage dependent pathway and is capable of binding to the mRNA transcript encoded by the target gene, which causes degradation of the mRNA transcript; and (iii) the second double stranded sequence comprises a sequence that is presented to a cleavage independent pathway and is capable of sequestering the mRNA transcript encoded by the target gene and repressing the translation thereof.