US2016319278A1PendingUtilityA1

Fully stabilized asymmetric sirna

Assignee: UNIV MASSACHUSETTSPriority: Apr 3, 2015Filed: Apr 1, 2016Published: Nov 3, 2016
Est. expiryApr 3, 2035(~8.6 yrs left)· nominal 20-yr term from priority
A61P 43/00A61P 25/14C12N 15/113C12N 2310/344C12N 2320/53C12Y 207/10001C12N 2310/315C12N 15/111A61P 15/00C12N 2310/3515C12N 15/1138C12N 2320/51C12N 2310/343C12N 2310/346C12N 2310/321A61P 1/16C12N 2310/14A61P 13/12
54
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Provided herein are self-delivering oligonucleotides that are characterized by efficient RISC entry, minimum immune response and off-target effects, efficient cellular uptake without formulation, and efficient and specific tissue distribution.

Claims

exact text as granted — not AI-modified
1 . An oligonucleotide of at least 16 contiguous nucleotides, said oligonucleotide having a 5′ end, a 3′ end and complementarity to a target, wherein:
 (1) the oligonucleotide comprises alternating 2′-methoxy-ribonucleotides and 2′-fluoro-ribonucleotides; 
 (2) the nucleotides at positions 2 and 14 from the 5′ end are not 2′-methoxy-ribonucleotides; 
 (3) the nucleotides are connected via phosphodiester or phosphorothioate linkages; and 
 (4) the nucleotides at positions 1-6 from the 3′ end, or positions 1-7 from the 3′ end, are connected to adjacent nucleotides via phosphorothioate linkages. 
 
     
     
         2 . (canceled) 
     
     
         3 . The oligonucleotide of  claim 1 , wherein the target is mammalian or viral mRNA. 
     
     
         4 . The oligonucleotide of  claim 3 , wherein the target is an intronic region of said mRNA. 
     
     
         5 . A double-stranded, chemically-modified nucleic acid, comprising a first oligonucleotide and a second oligonucleotide, wherein the first oligonucleotide is the oligonucleotide of  claim 1 , and
 (1) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide;   (2) the second oligonucleotide comprises alternating 2′-methoxy-ribonucleotides and 2′-fluoro-ribonucleotides;   (3) the nucleotides at positions 2 and 14 from the 3′ end of the second oligonucleotide are 2′-methoxy-ribonucleotides; and   (4) the nucleotides of the second oligonucleotide are connected via phosphodiester or phosphorothioate linkages.   
     
     
         6 . The nucleic acid of  claim 5 , wherein the second oligonucleotide is linked to a hydrophobic molecule at the 3′ end of the second oligonucleotide. 
     
     
         7 - 9 . (canceled) 
     
     
         10 . The nucleic acid of  claim 5 , wherein the nucleotides at positions 1 and 2 from the 3′ end of second oligonucleotide, and the nucleotides at positions 1 and 2 from the 5′ end of second oligonucleotide, are connected to adjacent ribonucleotides via phosphorothioate linkages. 
     
     
         11 . An oligonucleotide having the structure of compound (Ia):
   X(—K—B—K-A) j (—S—B—S-A) r (—S—B) t —OR   (Ia)
   wherein:
 X is selected from the group consisting of: 
   
       
         
           
           
               
               
           
         
         
           
           
               
               
           
         
         
           A, for each occurrence, independently is a 2′-methoxy-ribonucleotide; 
           B, for each occurrence, independently is a 2′-fluoro-ribonucleotide; 
           K, for each occurrence independently is a phosphodiester or phosphorothioate linker; 
           S is a phosphorothioate linker; 
           R, for each occurrence, independently is selected from hydrogen and a capping group; 
           j is 4, 5, 6 or 7; 
           r is 2 or 3; and 
           t is 0 or 1. 
         
       
     
     
         12 . The oligonucleotide of  claim 11 , wherein the oligonucleotide has the structure of compound (Ib):
   X-A(—S—B—S-A) m (—P—B—P-A) n (—P—B—S-A) q (—S—B—S-A) r (—S—B) t —OR   (Ib)
   wherein:
 P is a phosphodiester linker; 
 m is 0 or 1; 
 n is 4, 5 or 6; 
 q is 0 or 1; 
 r is 2 or 3; and 
 t is 0 or 1. 
   
     
     
         13 - 15 . (canceled) 
     
     
         16 . A double-stranded, chemically-modified nucleic acid comprising a first oligonucleotide and a second oligonucleotide, wherein:
 (1) the first oligonucleotide is the oligonucleotide of  claim 12 ;   (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; and   (3) the second oligonucleotide has the structure of compound (IL):
   C-L-B(—S-A-S—B) m′ (—P-A-P—B) n′ (—P-A-S—B) q′ (—S-A) t′ (—S—B) e —OR   (IIa)
 
   wherein:
 C is a hydrophobic molecule; 
 A, for each occurrence, independently is a 2′-methoxy-ribonucleotide; 
 B, for each occurrence, independently is a 2′-fluoro-ribonucleotide; 
 L is a linker comprising an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphodiester, a phosphorothioate, a phosphoramidate, an amide, a carbamate, or a combination thereof; 
 S is a phosphorothioate linker; 
 P is a phosphodiester linker; 
 R, for each occurrence, independently is hydrogen or a capping group; 
 m′ is 0 or 1; 
 n′ is 4, 5 or 6; 
 q′ is 0 or 1; 
 r′ is 0 or 1; and 
 t′ is 0 or 1. 
   
     
     
         17 . The nucleic acid of  claim 16 , wherein the hydrophobic molecule is cholesterol. 
     
     
         18 . The nucleic acid of  claim 16 , wherein the first oligonucleotide has 3-7 more ribonucleotides than the second oligonucleotide. 
     
     
         19 . The nucleic acid of  claim 16 , wherein the first oligonucleotide has the structure:
   X(—S—B—S-A)(—P—B—P-A) 5 (—P—B—S-A)(—S—B—S-A) 2 (—S—B)—OR;
   the second oligonucleotide has the structure:
   C-L-B(—S-A-S—B)(—P-A-P—B) 5 (—S-A)(—S—B)—OR; and
 
   the nucleic acid has the structure of compound (IIIa):   
       
         
           
           
               
               
           
         
         wherein each | represents a hydrogen bonding interaction. 
       
     
     
         20 . The nucleic acid of  claim 19 , wherein
 the first oligonucleotide comprises the sequence 5′ UAAAUUUGGAGAUCCGAGAG 3′ (SEQ ID NO: 4);   the second oligonucleotide comprises the sequence 3′ AUUUAAACCUCUAGG 5′ (SEQ ID NO: 5);   X is X3; and   C is cholesterol.   
     
     
         21 . The nucleic acid of  claim 19 , wherein
 the first oligonucleotide comprises the sequence 5′ UAUAAAUGGUAGCUAUGAUG 3′ (SEQ ID NO: 6);   the second oligonucleotide comprises the sequence 3′ AUAUUUACCAUCGAU 5′ (SEQ ID NO: 7);   X is X3; and   C is cholesterol.   
     
     
         22 . The nucleic acid of  claim 19 , wherein
 the first oligonucleotide comprises the sequence 5′ UUAAUCUCUUUACUGAUAUA 3′ (SEQ ID NO: 8);   the second oligonucleotide comprises the sequence 3′ AAUUAGAGAAAUGAC 5′ (SEQ ID NO: 9);   X is X3; and   C is cholesterol.   
     
     
         23 . The nucleic acid of  claim 16  wherein the first oligonucleotide has structure:
   X(—P—B—P-A) 6 (—P—B—S-A)(—S—B—S-A) 2 (—S—B)—OR;
 
 the second oligonucleotide has the structure:
   C-L-B(—S-A-S—B)(—P-A-P—B) 6 —OR; and
 
 
 the nucleic acid has the structure of compound (IIIb): 
 
       
         
           
           
               
               
           
         
         wherein each | represents a hydrogen bonding interaction. 
       
     
     
         24 . The nucleic acid of  claim 23 , wherein
 the first oligonucleotide comprises the sequence 5′ UAAAUUUGGAGAUCCGAGAG 3′ (SEQ ID NO: 4);   the second oligonucleotide comprises the sequence 3′ AUUUAAACCUCUAGG 5′ (SEQ ID NO: 5);   X is X3; and   C is cholesterol.   
     
     
         25 . The nucleic acid of  claim 23 , wherein
 the first oligonucleotide comprises the sequence 5′ UAUAAAUGGUAGCUAUGAUG 3′ (SEQ ID NO: 6);   the second oligonucleotide comprises the sequence 3′ AUAUUUACCAUCGAU 5′ (SEQ ID NO: 7);   X is X3; and   C is cholesterol.   
     
     
         26 . The nucleic acid of  claim 23 , wherein
 the first oligonucleotide comprises the sequence 5′ UUAAUCUCUUUACUGAUAUA 3′ (SEQ ID NO: 8);   the second oligonucleotide comprises the sequence 3′ AAUUAGAGAAAUGAC 5′ (SEQ ID NO: 9);   X is X3; and   C is cholesterol.   
     
     
         27 . The nucleic acid of  claim 16  wherein the first oligonucleotide has structure:
   X(—S—B—S-A)(—P—B—P-A) 5 (—S—B—S-A) 3 (—S—B)—OR;
 
 the second oligonucleotide has the structure:
   C-L-B(—S-A-S—B)(—P-A-P—B) 5 (—S-A-S—B)—OR; and
 
 
 the nucleic acid has the structure of Formula (IIIc): 
 
       
         
           
           
               
               
           
         
         wherein each | represents a hydrogen bonding interaction. 
       
     
     
         28 . The nucleic acid of  claim 27 , wherein
 the first oligonucleotide comprises the sequence 5′ UUAAUCUCUUUACUGAUAUA 3′ (SEQ ID NO: 8);   the second oligonucleotide comprises the sequence 3′ AAUUAGAGAAAUGAC 5′ (SEQ ID NO: 9);   X is X3; and   C is cholesterol.   
     
     
         29 . A pharmaceutical composition comprising one or more double-stranded, chemically-modified nucleic acid of  claim 16 , and a pharmaceutically acceptable carrier. 
     
     
         30 . The pharmaceutical composition of  claim 29 , comprising a first nucleic acid of compound (IIIa), wherein the first oligonucleotide comprises the sequence 5′ UAAAUUUGGAGAUCCGAGAG 3′ (SEQ ID NO: 4); the second oligonucleotide comprises the sequence 3′ AUUUAAACCUCUAGG 5′ (SEQ ID NO: 5); X is X3; and C is cholesterol; and a second nucleic acid of compound (IIIa), wherein the first oligonucleotide comprises the sequence 5′ UAUAAAUGGUAGCUAUGAUG 3′ (SEQ ID NO: 6); the second oligonucleotide comprises the sequence 3′ AUAUUUACCAUCGAU 5′ (SEQ ID NO: 7); X is X3; and C is cholesterol. 
     
     
         31 . A method of treating or managing a disease or disorder comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the pharmaceutical composition of  claim 29 . 
     
     
         32 . (canceled)

Join the waitlist — get patent alerts

Track US2016319278A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.