US2016319278A1PendingUtilityA1
Fully stabilized asymmetric sirna
Est. expiryApr 3, 2035(~8.6 yrs left)· nominal 20-yr term from priority
A61P 43/00A61P 25/14C12N 15/113C12N 2310/344C12N 2320/53C12Y 207/10001C12N 2310/315C12N 15/111A61P 15/00C12N 2310/3515C12N 15/1138C12N 2320/51C12N 2310/343C12N 2310/346C12N 2310/321A61P 1/16C12N 2310/14A61P 13/12
54
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
Provided herein are self-delivering oligonucleotides that are characterized by efficient RISC entry, minimum immune response and off-target effects, efficient cellular uptake without formulation, and efficient and specific tissue distribution.
Claims
exact text as granted — not AI-modified1 . An oligonucleotide of at least 16 contiguous nucleotides, said oligonucleotide having a 5′ end, a 3′ end and complementarity to a target, wherein:
(1) the oligonucleotide comprises alternating 2′-methoxy-ribonucleotides and 2′-fluoro-ribonucleotides;
(2) the nucleotides at positions 2 and 14 from the 5′ end are not 2′-methoxy-ribonucleotides;
(3) the nucleotides are connected via phosphodiester or phosphorothioate linkages; and
(4) the nucleotides at positions 1-6 from the 3′ end, or positions 1-7 from the 3′ end, are connected to adjacent nucleotides via phosphorothioate linkages.
2 . (canceled)
3 . The oligonucleotide of claim 1 , wherein the target is mammalian or viral mRNA.
4 . The oligonucleotide of claim 3 , wherein the target is an intronic region of said mRNA.
5 . A double-stranded, chemically-modified nucleic acid, comprising a first oligonucleotide and a second oligonucleotide, wherein the first oligonucleotide is the oligonucleotide of claim 1 , and
(1) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (2) the second oligonucleotide comprises alternating 2′-methoxy-ribonucleotides and 2′-fluoro-ribonucleotides; (3) the nucleotides at positions 2 and 14 from the 3′ end of the second oligonucleotide are 2′-methoxy-ribonucleotides; and (4) the nucleotides of the second oligonucleotide are connected via phosphodiester or phosphorothioate linkages.
6 . The nucleic acid of claim 5 , wherein the second oligonucleotide is linked to a hydrophobic molecule at the 3′ end of the second oligonucleotide.
7 - 9 . (canceled)
10 . The nucleic acid of claim 5 , wherein the nucleotides at positions 1 and 2 from the 3′ end of second oligonucleotide, and the nucleotides at positions 1 and 2 from the 5′ end of second oligonucleotide, are connected to adjacent ribonucleotides via phosphorothioate linkages.
11 . An oligonucleotide having the structure of compound (Ia):
X(—K—B—K-A) j (—S—B—S-A) r (—S—B) t —OR (Ia)
wherein:
X is selected from the group consisting of:
A, for each occurrence, independently is a 2′-methoxy-ribonucleotide;
B, for each occurrence, independently is a 2′-fluoro-ribonucleotide;
K, for each occurrence independently is a phosphodiester or phosphorothioate linker;
S is a phosphorothioate linker;
R, for each occurrence, independently is selected from hydrogen and a capping group;
j is 4, 5, 6 or 7;
r is 2 or 3; and
t is 0 or 1.
12 . The oligonucleotide of claim 11 , wherein the oligonucleotide has the structure of compound (Ib):
X-A(—S—B—S-A) m (—P—B—P-A) n (—P—B—S-A) q (—S—B—S-A) r (—S—B) t —OR (Ib)
wherein:
P is a phosphodiester linker;
m is 0 or 1;
n is 4, 5 or 6;
q is 0 or 1;
r is 2 or 3; and
t is 0 or 1.
13 - 15 . (canceled)
16 . A double-stranded, chemically-modified nucleic acid comprising a first oligonucleotide and a second oligonucleotide, wherein:
(1) the first oligonucleotide is the oligonucleotide of claim 12 ; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; and (3) the second oligonucleotide has the structure of compound (IL):
C-L-B(—S-A-S—B) m′ (—P-A-P—B) n′ (—P-A-S—B) q′ (—S-A) t′ (—S—B) e —OR (IIa)
wherein:
C is a hydrophobic molecule;
A, for each occurrence, independently is a 2′-methoxy-ribonucleotide;
B, for each occurrence, independently is a 2′-fluoro-ribonucleotide;
L is a linker comprising an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphodiester, a phosphorothioate, a phosphoramidate, an amide, a carbamate, or a combination thereof;
S is a phosphorothioate linker;
P is a phosphodiester linker;
R, for each occurrence, independently is hydrogen or a capping group;
m′ is 0 or 1;
n′ is 4, 5 or 6;
q′ is 0 or 1;
r′ is 0 or 1; and
t′ is 0 or 1.
17 . The nucleic acid of claim 16 , wherein the hydrophobic molecule is cholesterol.
18 . The nucleic acid of claim 16 , wherein the first oligonucleotide has 3-7 more ribonucleotides than the second oligonucleotide.
19 . The nucleic acid of claim 16 , wherein the first oligonucleotide has the structure:
X(—S—B—S-A)(—P—B—P-A) 5 (—P—B—S-A)(—S—B—S-A) 2 (—S—B)—OR;
the second oligonucleotide has the structure:
C-L-B(—S-A-S—B)(—P-A-P—B) 5 (—S-A)(—S—B)—OR; and
the nucleic acid has the structure of compound (IIIa):
wherein each | represents a hydrogen bonding interaction.
20 . The nucleic acid of claim 19 , wherein
the first oligonucleotide comprises the sequence 5′ UAAAUUUGGAGAUCCGAGAG 3′ (SEQ ID NO: 4); the second oligonucleotide comprises the sequence 3′ AUUUAAACCUCUAGG 5′ (SEQ ID NO: 5); X is X3; and C is cholesterol.
21 . The nucleic acid of claim 19 , wherein
the first oligonucleotide comprises the sequence 5′ UAUAAAUGGUAGCUAUGAUG 3′ (SEQ ID NO: 6); the second oligonucleotide comprises the sequence 3′ AUAUUUACCAUCGAU 5′ (SEQ ID NO: 7); X is X3; and C is cholesterol.
22 . The nucleic acid of claim 19 , wherein
the first oligonucleotide comprises the sequence 5′ UUAAUCUCUUUACUGAUAUA 3′ (SEQ ID NO: 8); the second oligonucleotide comprises the sequence 3′ AAUUAGAGAAAUGAC 5′ (SEQ ID NO: 9); X is X3; and C is cholesterol.
23 . The nucleic acid of claim 16 wherein the first oligonucleotide has structure:
X(—P—B—P-A) 6 (—P—B—S-A)(—S—B—S-A) 2 (—S—B)—OR;
the second oligonucleotide has the structure:
C-L-B(—S-A-S—B)(—P-A-P—B) 6 —OR; and
the nucleic acid has the structure of compound (IIIb):
wherein each | represents a hydrogen bonding interaction.
24 . The nucleic acid of claim 23 , wherein
the first oligonucleotide comprises the sequence 5′ UAAAUUUGGAGAUCCGAGAG 3′ (SEQ ID NO: 4); the second oligonucleotide comprises the sequence 3′ AUUUAAACCUCUAGG 5′ (SEQ ID NO: 5); X is X3; and C is cholesterol.
25 . The nucleic acid of claim 23 , wherein
the first oligonucleotide comprises the sequence 5′ UAUAAAUGGUAGCUAUGAUG 3′ (SEQ ID NO: 6); the second oligonucleotide comprises the sequence 3′ AUAUUUACCAUCGAU 5′ (SEQ ID NO: 7); X is X3; and C is cholesterol.
26 . The nucleic acid of claim 23 , wherein
the first oligonucleotide comprises the sequence 5′ UUAAUCUCUUUACUGAUAUA 3′ (SEQ ID NO: 8); the second oligonucleotide comprises the sequence 3′ AAUUAGAGAAAUGAC 5′ (SEQ ID NO: 9); X is X3; and C is cholesterol.
27 . The nucleic acid of claim 16 wherein the first oligonucleotide has structure:
X(—S—B—S-A)(—P—B—P-A) 5 (—S—B—S-A) 3 (—S—B)—OR;
the second oligonucleotide has the structure:
C-L-B(—S-A-S—B)(—P-A-P—B) 5 (—S-A-S—B)—OR; and
the nucleic acid has the structure of Formula (IIIc):
wherein each | represents a hydrogen bonding interaction.
28 . The nucleic acid of claim 27 , wherein
the first oligonucleotide comprises the sequence 5′ UUAAUCUCUUUACUGAUAUA 3′ (SEQ ID NO: 8); the second oligonucleotide comprises the sequence 3′ AAUUAGAGAAAUGAC 5′ (SEQ ID NO: 9); X is X3; and C is cholesterol.
29 . A pharmaceutical composition comprising one or more double-stranded, chemically-modified nucleic acid of claim 16 , and a pharmaceutically acceptable carrier.
30 . The pharmaceutical composition of claim 29 , comprising a first nucleic acid of compound (IIIa), wherein the first oligonucleotide comprises the sequence 5′ UAAAUUUGGAGAUCCGAGAG 3′ (SEQ ID NO: 4); the second oligonucleotide comprises the sequence 3′ AUUUAAACCUCUAGG 5′ (SEQ ID NO: 5); X is X3; and C is cholesterol; and a second nucleic acid of compound (IIIa), wherein the first oligonucleotide comprises the sequence 5′ UAUAAAUGGUAGCUAUGAUG 3′ (SEQ ID NO: 6); the second oligonucleotide comprises the sequence 3′ AUAUUUACCAUCGAU 5′ (SEQ ID NO: 7); X is X3; and C is cholesterol.
31 . A method of treating or managing a disease or disorder comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the pharmaceutical composition of claim 29 .
32 . (canceled)Join the waitlist — get patent alerts
Track US2016319278A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.