Methods and means for efficient skipping of at least one of the following exons of the human duchenne muscular dystrophy gene: 43, 46, 50-53

Abstract

The invention relates a method wherein a molecule is used for inducing and/or promoting skipping of at least one of exon 43, exon 46, exons 50-53 of the DMD pre-mRNA in a patient, preferably in an isolated cell of a patient, the method comprising providing said cell and/or said patient with a molecule. The invention also relates to said molecule as such.

1 . An isolated antisense oligonucleotide which is fully complementary to 8-22 consecutive nucleotides of a sequence of an exon of human dystrophin pre-mRNA, said oligonucleotide comprising a locked nucleic acid, wherein said sequence of said exon is selected from the group consisting of: 
       
         
           
                 
               
                   (SEQ ID NO: 2) 
                 
                   5′-AGAUAGUCUACAACAAAGCUCAGGUCGGAUUGACAUUAUUCAUAG 
                 
                     
                 
                   CAAGAAGACAGCAGCAUUGCAAAGUGCAACGCCUGUGG-3′, and 
                 
                     
                 
                   wherein said oligonucleotide is capable of 
                 
                     
                 
                   skipping exon 43; 
                 
                     
                 
                   (SEQ ID NO: 3) 
                 
                   5′-UUAUGGUUGGAGGAAGCAGAUAACAUUGCUAGUAUCCCACUUGAA 
                 
                     
                 
                   CCUGGAAAAGAGCAGCAACUAAAAGAAAAGC-3′, and 
                 
                     
                 
                   wherein said oligonucleotide is capable of 
                 
                     
                 
                   skipping exon 46; 
                 
                     
                 
                   (SEQ ID NO: 4) 
                 
                   5′-GCGGTAAACCGUUUACUUCAAGAGCUGAGGGCAAAGCAGCCUGAC 
                 
                     
                 
                   CUAGCUCCUGGACUGACCACUAUUGG-3′, and wherein 
                 
                     
                 
                   said oligonucleotide is capable of skipping exon 
                 
                     
                 
                   50; 
                 
                     
                 
                   (SEQ ID NO: 5) 
                 
                   5′-CUCCUACUCAGACUGUUACUCUGGUGACACAACCUGUGGUUACUA 
                 
                     
                 
                   AGGAAACUGCCAUCUCCAAACUAGAAAUGCCAUCUUCCUUGAUG 
                 
                     
                 
                   UUGGAGGUAC-3′, and wherein said oligonucleotide is 
                 
                     
                 
                   capable of skipping exon 51; 
                 
                     
                 
                   (SEQ ID NO: 6) 
                 
                   5′-AUGCAGGAUUUGGAACAGAGGCGUCCCCAGUUGGAAGAACUCAUU 
                 
                     
                 
                   ACCGCUGCCCAAAAUUUGAAAAACAAGACCAGCAAUCAAGAGGCU- 
                 
                     
                 
                   3′, and wherein said oligonucleotide is capable of 
                 
                     
                 
                   skipping exon 52, 
                 
                   and 
                 
                     
                 
                   (SEQ ID NO: 7) 
                 
                   5′-AAUGUUAAAGGAUUCAACACAAUGGCUGGAAGCUAAGGAAAAGCU 
                 
                     
                 
                   GAGCAGGUCUUAGGACAGGCCAGAG-3′, and wherein 
                 
                     
                 
                   said oligonucleotide is capable of skipping exon 
                 
                     
                 
                   53. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         2 . The isolated antisense oligonucleotide of  claim 1 , wherein the oligonucleotide is complementary to 10-22 consecutive nucleotides of said sequence of said exon. 
     
     
         3 . The isolated antisense oligonucleotide of  claim 2 , wherein the oligonucleotide is complementary to 12-20 consecutive nucleotides of said sequence of said exon. 
     
     
         4 . The isolated antisense oligonucleotide of  claim 3 , wherein said oligonucleotide is 13-18 nucleotides in length. 
     
     
         5 . The isolated antisense oligonucleotide of  claim 1 , wherein said oligonucleotide comprises 2′-O-methyl-phosphorothioate modifications. 
     
     
         6 . The isolated antisense oligonucleotide of  claim 1 , wherein said oligonucleotide comprises a peptide nucleic acid and a morpholino phosphorodiamidate or a combination thereof. 
     
     
         7 . The isolated antisense oligonucleotide of  claim 1 , wherein said oligonucleotide comprises a peptide nucleic acid. 
     
     
         8 . The isolated antisense oligonucleotide of  claim 1 , wherein said oligonucleotide comprises a morpholino phosphorodiamidate. 
     
     
         9 . The isolated antisense oligonucleotide of  claim 1 , wherein said LNA comprises 2′-O,4′-C-ethylene-bridge. 
     
     
         10 . The isolated antisense oligonucleotide of  claim 1 , wherein said oligonucleotide comprises a peptide linked phosphorodiamidate morpholino oligomer (PMO). 
     
     
         11 . The isolated antisense oligonucleotide of  claim 1 , wherein said oligonucleotide is capable of inducing exon skipping by at least 30%. 
     
     
         12 . The isolated antisense oligonucleotide of  claim 1 , wherein said oligonucleotide comprises a backbone selected from a group consisting of: a morpholino backbone, a carbamate backbone, a siloxane backbone, a sulfide backbone, a sulfoxide backbone, a sulfone backbone, a formacetyl backbone, a thioformacetyl backbone, a methyleneformacetyl backbone, a riboacetyl backbone, an alkene containing backbone, a sulfamate backbone, a sulfonate backbone, a sulfonamide backbone, a methyleneimino backbone, a methylenehydrazino backbone and an amide backbone. 
     
     
         13 . The isolated antisense oligonucleotide of  claim 1 , said oligonucleotide being RNA. 
     
     
         14 . A pharmaceutical composition comprising at least two distinct isolated antisense oligonucleotides as defined  claim 1 , wherein said pharmaceutical composition further comprises a pharmaceutically acceptable carrier, adjuvant, diluent and/or excipient. 
     
     
         15 . A method for treating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual, the method comprising administering to said individual a pharmaceutical composition of  claim 15 , wherein said composition induces skipping of exons of dystrophin pre-mRNA. 
     
     
         16 . A method for treating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in a cell, the method comprising administering to said cell a pharmaceutical composition of  claim 15 , wherein said composition induces skipping of exons of dystrophin pre-mRNA. 
     
     
         17 . A method for inducing skipping of an exon of human dystrophin pre-mRNA in a muscle cell, the method comprising contacting said cell with an oligonucleotide of  claim 1  for a time and under conditions which permit exon skipping. 18 (Original) A method for inducing skipping of an exon of human dystrophin pre-mRNA in a human subject, the method comprising administering an oligonucleotide of  claim 1  to said subject in an amount and for a time which is effective to induce exon skipping. 
     
     
         19 . A method for treating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual, the method comprising administering to said individual an oligonucleotide of  claim 1 , wherein said oligonucleotide induces skipping of an exon of a dystrophin pre-mRNA. 
     
     
         20 . A method for treating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in a cell, the method comprising administering to said cell one or more isolated oligonucleotides of  claim 1 .