Polymorphisms in the pde3a gene

Abstract

Embodiments of the invention are directed to identifying or treating a patient that would benefit from phosphodiesterase inhibitor therapy.

1 . A method for treating a patient with heart failure comprising treating the patient with an effective amount of a PDE3A inhibitor after the patient is determined to be homozygous for an ectotropic viral integration site-1 protein (Evi-1) insertional polymorphism in the promoter of the phosphodiesterase type 3A (PDE3A) gene. 
     
     
         2 . The method of  claim 1 , wherein the PDE3A inhibitor is amrinone, cilostazol, milrinone, quazinone, siguazodan, trequinsin, or enoximone. 
     
     
         3 . The method of  claim 1 , wherein the PDE3A inhibitor is enoximone. 
     
     
         4 . The method of  claim 1 , wherein the PDE3A inhibitor is administered at a dose of 15 mg to 100 mg. 
     
     
         5 . The method of  claim 4 , wherein the PDE3A inhibitor is administered 1, 2, 3 or more times a day. 
     
     
         6 . The method of  claim 4 , wherein the PDE3A inhibitor is administered 1, 2, 3, 4, 5, or more times a week. 
     
     
         7 . A method for evaluating a heart failure patient comprising analyzing a biological sample from the patient for the presence of an ectotropic viral integration site-1 protein (Evi-1) deletion or insertional polymorphism in the promoter of one or more phosphodiesterase type 3A (PDE3A) genes of the patient, wherein a patient determined to be homozygous for the insertional polymorphism is responsive to PDE3A inhibitor therapy. 
     
     
         8 . The method of  claim 7 , further comprising obtaining a biological sample from the patient. 
     
     
         9 . The method of  claim 8 , wherein the biological sample is a blood sample, a buccal smear, a tissue sample, or a primary culture of somatic cells from the patient. 
     
     
         10 . The method of  claim 7 , wherein analyzing the sample comprises performing nucleic acid sequencing, restriction digestion, allele-specific nucleic acid amplification, single-stranded conformational polymorphism analysis, or allele specific hybridization analysis. 
     
     
         11 . The method of  claim 7 , further comprising preparing a report containing information regarding the genotype of one or more PDE3A genes of the patient. 
     
     
         12 . The method of  claim 7 , wherein the patient has symptoms of or has been diagnosed with heart failure. 
     
     
         13 . The method of  claim 7 , wherein the patient is determined to be homozygous for the insertional polymorhpism in the PDE3A gene and is subsequently treated with a PDE3A inhibitor. 
     
     
         14 . The method of  claim 13 , wherein the PDE3A inhibitor is amrinone, cilostazol, milrinone, quazinone, siguazodan, trequinsin, enoximone. 
     
     
         15 . The method of  claim 14 , wherein the PDE3A inhibitor is enoximone. 
     
     
         16 . The method of  claim 13 , wherein the PDE3A inhibitor is administered at a dose of 15 mg to 100 mg. 
     
     
         17 . The method of  claim 13 , wherein the PDE3A inhibitor is administered 1, 2, 3 or more times a day. 
     
     
         18 . The method of  claim 13 , wherein the PDE3A inhibitor is administered 1, 2, 3, 4, 5, or more times a week. 
     
     
         19 . The method of  claim 7 , wherein the patient is determined not to be homozygous for the insertional polymorphism in the PDE3A gene and is subsequently treated with a non-PDE3A inhibitor treatment. 
     
     
         20 . A method for evaluating a patient having or at risk of developing heart failure for responsiveness to phosphodiesterase inhibitor therapy comprising obtaining a determination of the patient's genotype for a deletion or insertional polymorphism in a phosphodiesterase type 3A (PDE3A) gene, wherein homozygosity for the insertional polymorphism is predictive of responsiveness to phosphodiesterase inhibitor therapy for treating heart failure in the patient. 
     
     
         21 . The method of  claim 20 , wherein the nucleic acid sequence insertion comprises an ectotropic viral integration site-1 protein (Evi-1) binding site. 
     
     
         22 . The method of  claim 21 , wherein the Evi-1 binding site has a nucleic acid sequence of SEQ ID NO:2. 
     
     
         23 . The method of  claim 21 , further comprising obtaining a biological sample from the patient. 
     
     
         24 . The method of  claim 23 , wherein the biological sample is a blood sample, a buccal smear, a tissue sample, or a primary culture of somatic cells from the patient. 
     
     
         25 . The method of  claim 20 , further comprising obtaining a patient history. 
     
     
         26 . The method of  claim 20 , wherein the determination of the patient's genotype for an insertional polymorphism in a phosphodiesterase type 3A (PDE3A) gene is by nucleic acid sequencing, restriction digestion, allele-specific nucleic acid amplification, single-stranded conformational polymorphism analysis, or allele specific hybridization analysis. 
     
     
         27 . The method of  claim 20 , wherein the patient has symptoms of or has been diagnosed with heart failure. 
     
     
         28 . The method of  claim 20 , further comprising treating a patient determined to be homozygous for the insertional polymorphism in the PDE3A gene with a PDE3A inhibitor. 
     
     
         29 . The method of  claim 21 , further comprising treating a patient determined to not be homozygous for the insertional polymorphism in the PDE3A gene with a non-phosphodiesterase inhibitor treatment. 
     
     
         30 . A method of determining efficacy of phosphodiesterase type 3A (PDE3A) inhibition therapy comprising detecting a nucleic acid insertion having a nucleotide sequence of SEQ ID NO:2 in a promoter of one or both phosphodiesterase type 3A (PDE3A) genes of a subject. 
     
     
         31 . The method of  claim 30 , wherein the nucleic acid insertion is within the 2000 nucleotides 5′ of the transcription start site. 
     
     
         32 . The method of  claim 30 , wherein detection of the nucleic acid insertion uses at least one oligonucleotide that anneals to SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:3 and SEQ ID NO:4. 
     
     
         33 . The method of  claim 30 , wherein the detection method comprises at least one allele specific amplification primer or allele specific nucleic acid probe. 
     
     
         34 . The method of  claim 33 , wherein the allele specific amplification primer or allele specific nucleic acid probe specifically hybridizes with SEQ ID NO:2 under high stringency conditions. 
     
     
         35 . The method of  claim 30 , wherein the nucleic acid insertion is detected using nucleic acid amplification, nucleic acid hybridization, restriction fragment length polymorphism (RFLP) analysis, single stranded conformational polymorphism (SSCP) analysis, nucleic acid sequencing, denaturing high performance liquid chromatography, comparative genome hybridization, and/or Southern blotting. 
     
     
         36 . The method of  claim 35 , wherein nucleic acid amplification comprises polymerase chain reaction amplification or ligase chain reaction amplification. 
     
     
         37 . The method of  claim 35 , wherein nucleic acid hybridization detection method comprises an allele specific oligonucleotide probe or a microarray of nucleic acid probes. 
     
     
         38 . The method of  claim 30 , further comprising obtaining a biological sample from the patient. 
     
     
         39 . The method of  claim 38 , wherein the biological sample is a blood sample, a buccal smear, a tissue sample, or a primary culture of somatic cells from the patient. 
     
     
         40 . An isolated nucleic acid sequence comprising nucleotides 269 to nucleotide 307 of SEQ ID NO:3. 
     
     
         41 . The nucleic acid of  claim 40 , wherein the nucleic acid sequence comprises 50 consecutive nucleotides of SEQ ID NO:3 or SEQ ID NO:4. 
     
     
         42 . An amplification primer pair comprising two oligonucleotides that amplify a nucleic acid segment comprising nucleotides 274 to 302 of SEQ ID NO:3. 
     
     
         43 . The primer pair of  claim 42 , wherein a first primer comprises the nucleic acid sequence of SEQ ID NO:6 (CCACTGCCATTGACTAGCTG). 
     
     
         44 . The primer pair of  claim 42 , wherein a second primer comprises the nucleic acid sequence of SEQ ID NO:7 (GCCAAAAGGAGATCCTTGAGAT). 
     
     
         45 . A nucleic acid probe that specifically hybridizes to a phosphodiesterase type 3A nucleic acid comprising nucleotides 274 to 302 of SEQ ID NO:3. 
     
     
         46 . A kit for genotyping a phosphodiesterase type 3A gene comprising oligonucleotides of at least 10 contiguous nucleotides of SEQ ID NO:3 that amplify a nucleic acid segment comprising an ectotropic viral integration site-1 protein (Evi-1) binding site insertional polymorphism or a nucleic acid probe that specifically hybridizes to a PDE3A gene comprising an ectotropic viral integration site-1 protein (Evi-1) binding site insertional polymorphism.