Transposon for genome manipulation

Abstract

Disclosed is a vector comprising a piggyBac like element (PLE) transposon and/or transposase. Also disclosed are vectors comprising a combination of the vectors of the present disclosure, a transformation system comprising the vectors of the present disclosure, an oligonucleotide primer, methods of amplifying nucleotide sequences, methods of transforming a cell with a gene and a transgenic organism.

1 . A vector, comprising a piggyBac like element (PLE) transposon. 
     
     
         2 . The vector according to  claim 1 , wherein the 5′ and 3′ ends of the transposon are used to flank a gene which is to be transformed into a cell. 
     
     
         3 . The vector according to  claim 1 , wherein the PLE transposon is not a piggyBac transposon and/or wherein the PLE transposon does not comprise sub-terminal repeats. 
     
     
         4 . The vector according to  claim 1 , wherein the PLE transposon comprises at least one pair of an inverted terminal repeat at the 5′ and 3′ ends of the transposon. 
     
     
         5 . The vector according to  claim 4 , wherein the inverted terminal repeat is an imperfect inverted terminal repeat. 
     
     
         6 . The vector according to  claim 5 , wherein the imperfect inverted terminal repeat comprises cccttttgcagttagaggga (SEQ ID NO: 28) and tccttataaccgttaaaggg (SEQ ID NO: 29). 
     
     
         7 . (canceled) 
     
     
         8 . The vector according to  claim 1 , wherein the PLE transposon comprises SEQ ID NO:1; or a sequence with at least 70%, at least 75%, at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 98%, or at least 99% identity to SEQ ID NO: 1. 
     
     
         9 . The vector, according to  claim 1 , comprising SEQ ID NO: 4 (PLE-wu 5′ end) or SEQ ID NO: 24 (5′ end of truncated/short PLE-wu); or a sequence with at least 70%, at least 75%, at least 80% or at least 85%, or at least 90%, or at least 95% identity to SEQ ID NO: 4; and/or SEQ ID NO: 5; SEQ ID NO: 24 (5′ end of truncated/short PLE-wu) and/or SEQ ID NO: 25 (3′ end of truncated/short PLE-wu); or a sequence with at least 80% or at least 85%, or at least 90%, or at least 95%, or at least 98%, or at least 99% identity to SEQ ID NO: 5 (PLE-wu 3′ end) or SEQ ID NO: 25 (3′ end of truncated/short PLE-wu). 
     
     
         10 . A vector, comprising a nucleotide sequence encoding a piggyBac like element (PLE) transposase. 
     
     
         11 . The vector according to  claim 10 , wherein the transposase is used to excise a gene flanked by the 5′ and 3′ ends of a PLE transposon and to integrate the gene into the chromosomes of a cell. 
     
     
         12 . The vector according to  claim 10 , wherein the transposase is not a piggyBac transposase. 
     
     
         13 . The vector according to  claim 10 , wherein the PLE transposase comprises an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 27; or an amino acid sequence with at least 70%, at least 75%, at least 80%, or at least 85%, or at least 90%, or at least 95% identity, or at least 98%, or at least 99% to SEQ ID NO: 2 or SEQ ID NO: 27. 
     
     
         14 . The vector according to  claim 10 , wherein the nucleotide sequence encoding the PLE transposase comprises SEQ ID NO: 3 or SEQ ID NO: 28 or a sequence with at least 70%, at least 75%, at least 80%, or at least 85%, or at least 90%, or at least 95% identity, or at least 98%, or at least 99% to SEQ ID NO: 3 or SEQ ID NO: 28. 
     
     
         15 . (canceled) 
     
     
         16 . The vector according to  claim 11 , wherein the PLE transposase includes a 1 to 350 residues, 50 to 150 residues or 132 residues deletion of the N-terminal of the PLE transposase, which enhances the activity of the PLE transposase. 
     
     
         17 . The vector according to  claim 16 , wherein the PLE transposase comprises SEQ ID NO: 27. 
     
     
         18 . The vector according to  claim 17 , wherein the PLE transposase comprises an amino acid sequence of SEQ ID NO: 25 or an amino acid sequence with at least 70%, at least 75%, at least 80%, or at least 85%, or at least 90%, or at least 95% identity, or at least 98%, or at least 99% to SEQ ID NO: 25. 
     
     
         19 . The vector according to  claim 1 , to be used in combination with a vector, comprising a nucleotide sequence encoding a piggyBac like element (PLE) transposase. 
     
     
         20 - 27 . (canceled) 
     
     
         28 . A transformation system, comprising
 a) a first vector, comprising a piggyBac like element (PLE) transposon; and   a second vector, comprising a nucleotide sequence encoding a piggyBac like element (PLE) transposase; or   b) a single vector comprising the piggyBac like element transposon and the nucleotide sequence that encodes the piggyBac like element transposase.   
     
     
         29 . The transformation system according to  claim 28 , wherein the first vector comprises any one of SEQ ID NOs: 4 and 5; or a sequence with at least 70%, at least 75%, at least 80% or at least 85%, or at least 90%, or at least 95% identity, or at least 98%, or at least 99% to any one of SEQ ID NOs: 4 and 5. 
     
     
         30 . The transformation system according to  claim 28 , wherein the second vector comprises either SEQ ID NO: 3; or a sequence with at least 70%, at least 75%, at least 80% or at least 85%, or at least 90%, or at least 95%, or at least 98%, or at least 99% identity to SEQ ID NO: 3; or a nucleotide sequence which encodes an amino acid sequence of SEQ ID NO: 2; or a nucleotide sequence which encodes an amino acid sequence with at least 70%, at least 75%, at least 80% or at least 85%, or at least 90%, or at least 95%, or at least 98%, or at least 99% identity to SEQ ID NO: 2. 
     
     
         31 - 40 . (canceled) 
     
     
         41 . A kit for transforming a cell, comprising one or more vectors, wherein each vector comprises piggyBac like element (PLE) transposon. 
     
     
         42 . The kit according to  claim 41 , comprising a first vector, comprising a piggyBac like element (PLE) transposon; and
 a second vector, comprising a nucleotide sequence encoding a piggyBac like element (PLE) transposase.   
     
     
         43 . The kit according to  claim 42 , wherein the first vector comprises any one of SEQ ID NOs: 4 and 5; or a sequence with at least 70%, at least 75%, at least 80% or at least 85%, or at least 90%, or at least 95% identity to any one of SEQ ID NOs: 4 and 5; optionally wherein the second vector comprises either SEQ ID NO: 3; or a sequence with at least 70%, at least 75%, at least 80% or at least 85%, or at least 90%, or at least 95%, or at least 98%, or at least 99% identity to SEQ ID NO: 3; or a nucleotide sequence which encodes an amino acid sequence of SEQ ID NO: 2; or a nucleotide sequence which encodes an amino acid sequence with at least 70%, at least 75%, at least 80% or at least 85%, or at least 90%, or at least 95%, or at least 98%, or at least 99% identity to SEQ ID NO: 2. 
     
     
         44 - 46 . (canceled) 
     
     
         47 . A kit for transforming a cell, comprising a single vector comprising a piggyBac like element transposon and a nucleotide sequence that encodes the piggyBac like element transposase. 
     
     
         48 . (canceled) 
     
     
         49 . A method of amplifying a nucleotide sequence of any one of SEQ ID NOs: 1, 3, 4 or 5, wherein the amplification of SEQ ID NO: 1 comprises performing a polymerase chain reaction using a forward primer comprising the nucleotide sequence of SEQ ID NO: 6 and a reverse primer comprising the nucleotide sequence of SEQ ID NO: 7; wherein the amplification of SEQ ID NO: 3 comprises performing a polymerase chain reaction using a forward primer comprising nucleotide sequence of SEQ ID NO: 8 and a reverse primer comprising nucleotide sequence of SEQ ID NO: 9; wherein the amplification of SEQ ID NO: 4 comprises performing a polymerase chain reaction using a forward primer comprising nucleotide sequence of SEQ ID NO: 10 and a reverse primer comprising nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 20; wherein the amplification of SEQ ID NO: 5 comprises performing a polymerase chain reaction using a forward primer comprising nucleotide sequence of SEQ ID NO: 12 and a reverse primer comprising nucleotide sequence of SEQ ID NO: 13. 
     
     
         50 - 52 . (canceled) 
     
     
         53 . A method of transforming a cell with a gene, comprising:
 a) transfecting the cell with a first vector, comprising a piggyBac like element (PLE) transposon, wherein the first vector comprises the 5′ and 3′ ends of a piggyBac like element (PLE) transposon; and   transfecting the cell with a second vector, comprising a nucleotide sequence encoding a piggyBac like element (PLE) transposase, wherein the second vector comprises a nucleotide sequence that encodes a piggyBac like element transposase; or   b) transfecting the cell with a single vector, wherein the single vector comprises the 5′ and 3′ ends of the piggyBac like element transposon and the nucleotide sequence that encodes the PLE transposase.   
     
     
         54 . The method according to  claim 53 , wherein the first vector comprises any one of SEQ ID NOs: 4 and 5; or a sequence with at least 70%, at least 75%, at least 80% or at least 85%, or at least 90%, or at least 95%, or at least 98%, or at least 99% identity to any one of SEQ ID NOs: 4 and 5; optionally wherein the second vector comprises SEQ ID NO: 3; or a sequence with at least 70%, at least 75%, at least 80% or at least 85%, or at least 90%, or at least 95% or at least 98%, or at least 99% identity to SEQ ID NO: 3; or a nucleotide sequence which encodes an amino add sequence of SEQ ID NO: 2; or a nucleotide sequence which encodes an amino acid sequence with at least 70%, or at least 75%, at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 98%, or at least 99% identity to SEQ ID NO: 2. 
     
     
         55 . (canceled) 
     
     
         56 . (canceled) 
     
     
         57 . A method of transforming a cell with a gene, comprising:
 transfecting the cell with a first vector, wherein the first vector comprises the 5′ and 3′ ends of a piggyBac like element (PLE) transposon; and   delivering a nucleic acid encoding a nucleotide sequence encoding a piggyBac like element (PLE) transposase or a transposase protein either together with the first vector or before transfection of the first vector or after transfection of the first vector.   
     
     
         58 . A method of transforming a cell with a gene, comprising:
 delivering a nucleic acid encoding a nucleotide sequence encoding a piggyBac like element (PLE) transposase or a transposase protein into the cell, wherein the cell already comprises the 5′ and 3′ ends of a piggyBac like element (PLE) transposon.   
     
     
         59 - 61 . (canceled) 
     
     
         62 . A non-human transgenic organism comprising cells which have been transformed by a method of transforming a cell with a gene, comprising:
 a) transfecting the cell with a first vector, comprising a piggyBac like element (PLE) transposon, wherein the first vector comprises the 5′ and 3′ ends of a piggyBac like element (PLE) transposon; and transfecting the cell with a second vector, comprising a nucleotide sequence encoding a piggyBac like element (PLE) transposase, wherein the second vector comprises a nucleotide sequence that encodes a piggyBac like element transposase; or   b) transfecting the cell with a single vector, wherein the single vector comprises the 5′ and 3′ ends of the of piggyBac like element transposon and the nucleotide sequence that encodes the PLE transposase.   
     
     
         63 - 65 . (canceled)