US2017292125A1PendingUtilityA1
Multiple exon skipping compositions for dmd
Est. expiryOct 24, 2028(~2.3 yrs left)· nominal 20-yr term from priority
A61P 21/00A61P 21/04C12N 15/111C12N 2310/331C12N 2320/33C12N 2310/3233C12N 2310/3341C12N 2310/11C12N 2320/30C12N 15/113C12N 2310/321C12N 2310/3513A61K 48/00
66
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.
Claims
exact text as granted — not AI-modified1 - 65 . (canceled)
66 . An antisense oligonucleotide of formula (I):
or a pharmaceutically acceptable salt thereof, wherein:
Z is 19;
R is H or —C(O)CH 3 , and
each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 21 consecutive bases of exon 53 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of TGTTGCCTCCGGTTCTGAAGGTGTTCTIGT (SEQ ID NO: 631), and
wherein the antisense oligonucleotide induces exon 53 skipping.
67 . A pharmaceutical composition comprising an antisense oligonucleotide of formula (I):
or a pharmaceutically acceptable salt thereof, wherein:
Z is 19;
R is H or —C(O)CH 3 , and
each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 21 consecutive bases of exon 53 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of TGTTGCCTCCGGTTCTGAAGGTGTTCTIGT (SEQ ID NO: 631), and
wherein the antisense oligonucleotide induces exon 53 skipping.Cited by (0)
No later patents cite this yet.
References (0)
No backward citations on record.