Multiple exon skipping compositions for dmd

Abstract

Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.

1 - 65 . (canceled) 
     
     
         66 . An anti sense oligonucleotide of formula (I): 
       
         
           
           
               
               
           
         
         or a pharmaceutically acceptable salt thereof, wherein: 
         Z is 19; 
         R is H or —C(O)CH 3 , and 
         each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 21 consecutive bases of exon 53 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of TGTTGCCTCCGGTTCTGAAGGTGTTCTTGT (SEQ ID NO: 631), and wherein the antisense oligonucleotide induces exon 53 skipping. 
       
     
     
         67 . A pharmaceutical composition comprising an antisense oligonucleotide of formula (I): 
       
         
           
           
               
               
           
         
         or a pharmaceutically acceptable salt thereof, wherein: 
         Z is 19; 
         R is H or —C(O)CH 3 , and 
         each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 21 consecutive bases of exon 53 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of TGTTGCCTCCGGTTCTGAAGGTGTTCTTGT (SEQ ID NO: 631), and wherein the antisense oligonucleotide induces exon 53 skipping. 
       
     
     
         68 . An antisense oligonucleotide of formula (I): 
       
         
           
           
               
               
           
         
         or a pharmaceutically acceptable salt thereof, wherein: 
         Z is 23; 
         R is H or —C(O)CH 3 , and 
         each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 25 consecutive bases of exon 53 of the human dystrophin pre-mRNA, wherein the base sequence comprises 25 consecutive bases of TGTTGCCTCCGGTTCTGAAGGTGTTCTTGT (SEQ ID NO: 631), and wherein the antisense oligonucleotide induces exon 53 skipping. 
       
     
     
         69 . A pharmaceutical composition comprising an antisense oligonucleotide of formula (I): 
       
         
           
           
               
               
           
         
         or a pharmaceutically acceptable salt thereof, wherein: 
         Z is 23; 
         R is H or —C(O)CH 3 , and 
         each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 25 consecutive bases of exon 53 of the human dystrophin pre-mRNA, wherein the base sequence comprises 25 consecutive bases of TGTTGCCTCCGGTTCTGAAGGTGTTCTTGT (SEQ ID NO: 631), and wherein the antisense oligonucleotide induces exon 53 skipping.