US2018119224A1PendingUtilityA1
Identification of gene associated with reading disability and uses therefor
Est. expirySep 14, 2024(expired)· nominal 20-yr term from priority
C12Q 2600/156C12Q 2600/158C12Q 1/6883C12Q 2600/172
49
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
The present invention relates to identification of a human gene, DCDC2 (MIM: 605755), associated with susceptibility for developing reading disability (RD), which is useful in identifying or aiding in identifying individuals at risk for developing RD, as well as for diagnosing or aiding in the diagnosis of RD.
Claims
exact text as granted — not AI-modified1 - 33 . (canceled)
34 . A diagnostic kit for detecting a variant doublecortin domain containing 2 (DCDC2) gene associated with susceptibility for developing RD in a sample from an individual, wherein the variant DCDC2 gene comprises an alteration that is (a) a deletion in intron 2 comprising SEQ ID NO: 75 or (b) an allele of the short tandem repeat region of intron 2 that comprises one of SEQ ID NO: 77-SEQ ID NO: 86, comprising:
(a) at least one container means having disposed therein a polynucleotide probe that hybridizes, under highly stringent conditions, to the variant DCDC2 gene, but not to a wild type DCDC2 gene; and (b) a label and/or instructions for the use of the diagnostic kit in the detection of the variant DCDC2 gene in a sample.
35 . A diagnostic kit for detecting a variant doublecortin domain containing 2 (DCDC2) gene, in a sample from an individual, comprising:
(a) at least one container means having disposed therein a polynucleotide primer that hybridizes to one side of an alteration in variant DCDC2 DNA that is present in the variant DCDC2 gene but not present in a wild type DCDC2 gene and a second polynucleotide primer that hybridizes to the other side of an alteration in variant DCDC2 DNA that is present in the variant DCDC2 gene but not present in a wild type DCDC2 gene; and (b) a label and/or instructions for the use of the diagnostic kit in the detection of an alteration in variant DCDC2 gene in a sample.
36 . The diagnostic kit of claim 35 , additionally comprising amplification reagents.
37 . The kit of claim 34 , wherein the deletion comprises SEQ ID NO: 75 and the polynucleotide probe hybridizes to intron 2 at the flanking base at the start of the deletion in intron 2 and at the flanking base at the end of the deletion in intron 2, wherein the flanking base at the start of the deletion is C and the flanking base at the end of the deletion is T.
38 . The kit of claim 34 having disposed therein a combination of three polynucleotides: a universal or shared forward primer; a reverse primer for non-deleted chromosomes and a reverse primer for deleted chromosomes.
39 . The kit of claim 38 , wherein the sequence of the universal or shared forward primer is AGCCTGCCTACCACAGAGAA; (SEQ ID NO: 3); the sequence of the deletion reverse primer is TGAAACCCCGTCTCTACTGAA; (SEQ ID NO: 4); and the sequence of the non-deletion reverse primer is GGAACAACCTCACAGAAATGG. (SEQ ID NO: 5).Join the waitlist — get patent alerts
Track US2018119224A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.