Methods for engineering allogeneic and immunosuppressive resistant t cell for immunotherapy

Abstract

Methods for developing engineered T-cells for immunotherapy that are both non-alloreactive and resistant to immunosuppressive drugs. The present invention relates to methods for modifying T-cells by inactivating both genes encoding target for an immunosuppressive agent and T-cell receptor, in particular genes encoding CD52 and TCR. This method involves the use of specific rare cutting endonucleases, in particular TALE-nucleases (TAL effector endonuclease) and polynucleotides encoding such polypeptides, to precisely target a selection of key genes in T-cells, which are available from donors or from culture of primary cells. The invention opens the way to standard and affordable adoptive immunotherapy strategies for treating cancer and viral infections.

1 - 25 . (canceled) 
     
     
         26 . An isolated genetically-modified human T cell in which a T-cell receptor (TCR) alpha gene has been modified by cleavage and integration into the TCR alpha constant chain region of an exogenous nucleic acid successively comprising:
 a first region of homology to sequences upstream of said cleavage,   an exogenous polynucleotide sequence encoding a Chimeric Antigen Receptor, and   a second region of homology to sequences downstream of said cleavage,   wherein the Chimeric Antigen Receptor comprises a binding domain against a tumor antigen present on a target cell.   wherein the cell expresses the Chimeric Antigen Receptor, and   wherein the integration results in reduced TCR expression on the cell surface.   
     
     
         27 . The isolated genetically-modified human T cell of  claim 26 , wherein the integration into the TCR alpha constant chain region is at a position within the sequence: 
       
         
           
                 
               
                   (SEQ ID NO: 60) 
                 
                 
               
                   TGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAA. 
                 
             
                
               
            
             
                
               
            
           
         
       
     
     
         28 . A pharmaceutical composition comprising the isolated genetically-modified human T cell of  claim 26 . 
     
     
         29 . A population of the isolated genetically-modified human T cells of  claim 26 . 
     
     
         30 . A pharmaceutical composition comprising the population of isolated genetically-modified human T cells of  claim 29 . 
     
     
         31 . A method of immunotherapy for treating a patient with cancer comprising administering the pharmaceutical composition of  claim 28  to a patient in need thereof. 
     
     
         32 . An isolated genetically-modified human T cell, comprising an exogenous polynucleotide sequence encoding a Chimeric Antigen Receptor inserted into the T-cell receptor (TCR) alpha constant chain region in the genome of said cell;
 wherein the Chimeric Antigen Receptor comprises a binding domain against a tumor antigen present on a target cell,   wherein the cell expresses the Chimeric Antigen Receptor, and   wherein the cell has reduced TCR expression on the cell surface when compared to normal T lymphocytes.   
     
     
         33 . An isolated genetically-modified human T cell comprising in its genome:
 an inactivated T-cell receptor (TCR) alpha gene of said cell, and   a polynucleotide expressing a Chimeric Antigen Receptor (CAR);   wherein integration of the polynucleotide expressing the CAR into the TCR alpha gene inactivates the TCR alpha gene.