US2019085079A1PendingUtilityA1

Chimeric antigen receptors and methods of making

Assignee: UNIV TEXASPriority: Feb 14, 2014Filed: Sep 28, 2018Published: Mar 21, 2019
Est. expiryFeb 14, 2034(~7.5 yrs left)· nominal 20-yr term from priority
A61P 31/04A61P 35/02A61P 31/10A61P 31/12A61P 35/00A61P 31/00C12N 9/1241C07K 2319/02C12Y 207/07C07K 14/70578C12N 15/85C07K 14/70517C07K 14/7051C07K 2319/03C07K 2317/622C07K 14/4748C07K 16/2803C07K 2319/00A61K 2035/124C07K 14/4746C07K 14/70521A61K 35/17A61K 40/11A61K 40/42A61K 40/31A61K 40/15A61K 40/4215A61K 40/4211C12N 2510/04A61K 2239/48C12N 5/0638C12N 15/1082C07K 19/00C07K 14/70503C07K 16/28
57
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Provided are methods of generating chimeric antigen receptors (CAR). In some embodiments, library screening of CAR is performed by generating a vector encoding the CAR from random attachment of vectors from libraries of vectors encoding antigen-binding domains (e.g., scFv regions), hinge regions, and endodomains. In some embodiments, the vectors contain a transposon.

Claims

exact text as granted — not AI-modified
1 . A composition comprising:
 (a) a plurality of first vectors encoding one or more distinct antigen binding domains;   (b) a plurality of second vectors encoding one or more distinct hinge domains; and   (c) a plurality of third vectors encoding one or more distinct endodomains;   wherein at least two of the first, second and third vectors comprise a plurality of two or more vectors encoding distinct antigen binding domains, hinge domains and/or endodomains, respectively, and further wherein the vectors comprise sites for homologous recombination to permit the generation of a fourth vector encoding a chimeric antigen receptor (CAR).   
     
     
         2 . The composition of  claim 1 , wherein the plurality of first vectors encodes a plurality of distinct antigen binding domains, the plurality of second vectors encodes one hinge domain, and the plurality of third vectors encodes a plurality of distinct endodomains. 
     
     
         3 . The composition of  claim 1 , wherein the plurality of first vectors encodes a plurality of distinct antigen binding domains, the plurality of second vectors encodes a plurality of distinct hinge domains, and the plurality of third vectors encodes a plurality of distinct endodomains. 
     
     
         4 . The composition of  claim 1 , wherein the plurality of first vectors encodes a plurality of distinct antigen binding domains, the plurality of second vectors encodes a plurality of distinct hinge domains, and the plurality of third vectors encodes a one endodomain. 
     
     
         5 . The composition of  claim 1 , wherein the plurality of first vectors encodes one antigen binding domain, the plurality of second vectors encodes a plurality of distinct hinge domains, and the plurality of third vectors encodes a plurality of distinct endodomains. 
     
     
         6 - 8 . (canceled) 
     
     
         9 . The composition of  claim 1 , wherein the composition further comprises a plurality of fifth vectors encoding one or more transmembrane domain; wherein the first vectors, the second vectors, the third vectors, and the fifth vectors comprise sites for homologous recombination to generate a fourth vector encoding a chimeric antigen receptor (CAR). 
     
     
         10 - 19 . (canceled) 
     
     
         20 . The composition of  claim 1 , wherein the antigen binding domain selectively binds CD19, Universal Antigen (mouse), HER-3, GD2, Gp75, CS1 protein, mesohelin, phosphatidylserine, cMyc, CD22, CD4, CD44v6, CD45, CD28, CD3, CD3e, CD123, CD138, CD52, CD56, CD74, CD30, Gp75, CD38, CD33, CD20, Her1/HER3 fusion, GD2, a carbohydrate,  Aspergillus , ROR1, c-MET, EGFR, Dectin, Ebola, a fungus, GP, HERV-K (HERVK), NY-ESO-1, VEGF-R2, TGF-b2R, IgG4, Biotin, or 0-AcGD2. 
     
     
         21 . (canceled) 
     
     
         22 . The composition of  claim 1 , wherein the hinge region encodes the 12 AA peptide (GAGAGCAAGTACGGCCTCCTCCCTGCCCCCCTTGCCCCT, SEQ ID NO: 1), t-20 AA peptide, IgG4 Fc Δ EQ, IgG4 Fe Δ Q, (t-12AA+t-20AA), mKate, phiLov, dsRed, Venus, eGFP, CH3 HA, CD8α+t-20AA), Double t-20 AA, (t-20AA+CD8α), (CD8α+Leucine Zipper Basep1), (CD8α+Leucine Zipper Acid1), 2D3, CD8α, or IgG4 Fc. 
     
     
         23 . The method of  claim 1 , wherein at least one of the endodomains comprise CD3ζ. 
     
     
         24 . The method of  claim 1 , wherein at least one of the endodomains comprises one or more ITAM domains. 
     
     
         25 . The method of  claim 1 , wherein at least one of the endodomains comprise (CD28+CD3ζ, (CD28+CD27+CD3ζ), (CD28+OX40+CD3ζ), (CD28+4-1BB+CD3ζ), (CD28+CD27+OX40+CD3ζ), (CD28+4-1BB+CD27+CD3ζ), (CD28+4-1BB+OX40+CD3ζ), (4-1BB+CD3ζ), (4-1BB+OX40+CD3ζ), (4-1BB+CD27+CD3ζ), (CD27+CD3ζ), (CD27+OX40+CD3ζ), (CD28A+CO3Q, (CD28A+CD27+CD3ζ), (CD28A+OX40+CD3ζ), (CD28A+4-1BB+CD3ζ), (CD28A+4-1BB+OX40+CD3ζ), (CD28A+CD27+OX40+CD3ζ), (CD28A+4-BB+CD27+CD3ζ), (4-1BB+ICOS+CD3ζ), (CD28+ICOS+CD3ζ), (ICOS+CD3ζ), CD3ζ, or CD28 only. 
     
     
         26 . (canceled) 
     
     
         27 . A method of producing a plurality of vectors each encoding a chimeric antigen receptor (CAR) comprising:
 (i) obtaining the composition comprising a plurality of first vectors encoding one or more distinct antigen binding domains; a plurality of second vectors encoding one or more distinct hinge domains; and a plurality of third vectors encoding one or more distinct endodomains; wherein at least two of the first, second and third vectors comprise a plurality of two or more vectors encoding distinct antigen binding domains, hinge domains and/or endodomains, respectively, and further wherein the vectors comprise sites for homologous recombination to permit the generation of a fourth vector encoding a chimeric antigen receptor (CAR); and   (ii) subjecting the composition to conditions sufficient to allow for the distinct antigen binding domains, hinge domains and/or endodomains encoded by said vectors to recombine via homologous recombination to produce a plurality of fourth vectors, wherein each of said fourth vectors encodes a CAR.   
     
     
         28 . The method of  claim 27 , wherein the method further comprises expressing the CAR in a cell. 
     
     
         29 . The method of  claim 27 , wherein the method further comprises testing the CAR for activity. 
     
     
         30 - 43 . (canceled) 
     
     
         44 . The method of  claim 27 , wherein the first vectors, the second vectors, and/or the third vectors encode a transposase. 
     
     
         45 . The method of  claim 27 , wherein a sixth vector encodes a transposase, and wherein the method comprises introducing, electroporating, or transfecting one or more of said fourth vectors and said sixth vector into a cell. 
     
     
         46 . (canceled) 
     
     
         47 . The method of  claim 27 , further comprising culturing or providing cells transfected with the CAR in the presence of artificial antigen presenting cells (aAPCs) that can stimulate expansion of the CAR-expressing T-cells. 
     
     
         48 - 52 . (canceled) 
     
     
         53 . The method of  claim 28 , wherein the cell is a T cell or a pluripotent cell. 
     
     
         54 - 66 . (canceled) 
     
     
         67 . The method of  claim 29 , wherein said activity comprises ability of the CAR to selectively bind a cancer cell, selectively bind a pathogen, selectively bind a cell involved in an autoimmune disease or promote activation of a T-cell, destruction of a T cell, differentiation of a T cell, proliferation of a T cell, de-differentiation of a T cell, movement of a T cell, cytokine production by a T cell, or killing by a T cell. 
     
     
         68 - 88 . (canceled)

Join the waitlist — get patent alerts

Track US2019085079A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.