US2019085330A1PendingUtilityA1

miRNAs USEFUL FOR IDENTIFYING TARGETS ASSOCIATED WITH CANCER

Assignee: UNIV CITY NEW YORK RES FOUNDPriority: Oct 29, 2015Filed: Nov 26, 2018Published: Mar 21, 2019
Est. expiryOct 29, 2035(~9.2 yrs left)· nominal 20-yr term from priority
C12N 15/113C12Q 1/6886C12Q 2600/178C12N 2310/141C12N 2310/53
46
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Several miRNAs are described that are useful in diagnosing and treating prostate cancer, or pancreatic cancer. The miRNAs bind with targets that are associated with prostate cancer or pancreatic cancer. This permits the identification of those targets as well as a treatment methodology for prostate cancer.

Claims

exact text as granted — not AI-modified
What is claimed is: 
     
         1 . A method for absolute quantification of a miRNA using polymerase chain reaction (PCR), the method comprising steps of:
 creating a standard curve using a duplex micro-ribonucleic acid (microRNA) composition comprising:
 a mature strand comprising a primarily structure selected from the group consisting of: 
   
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 1) 
                 
                     
                   UCAGCUGGCCCUCAUUUCX 1 X 2 , 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 3) 
                 
                     
                   GGUCCAGAGGGGAGAUAGGUUCCUX 1 X 2 , 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 5) 
                 
                     
                   UGGCUCAGUUCAGCAGGAACAGUCX 1 X 2 , 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 7) 
                 
                     
                   UCUGCAGGGUUUGCUUUGAGX 1 X 2 , 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 9) 
                 
                     
                   UUUGAGGCUACAGUGAGAUGUGCAX 1 X 2 ; 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
         
           wherein a X 1  and X 2  are each independently selected from A, G, C, or T to define a first overhang with at least two residues that include X 1  and X 2  and less than five residues, wherein the mature strand has fewer than thirty residues, the mature strand having a 3′ end; 
           a passenger strand having between twenty and twenty-five residues including a second overhang of between two and seven residues, the passenger strand being hydrogen bonded to the mature strand, the passenger strand being at least 80% complementary, but less than 100% complementary with respect to the mature strand such that there is at least one mismatch; and biotin bound to the 3′ end of the mature strand; 
         
         obtaining an output signal from a polymerase chain reaction (PCR) that was performed on a sample such that the PCR replicates an endogenous miRNA that corresponds to the mature strand; 
         comparing the output signal to the standard curve to quantify the concentration of the duplex micro-ribonucleic acid (microRNA). 
       
     
     
         2 . The method as recited in  claim 1 , wherein the mature strand comprises UCAGCUGGCCCUCAUUUCX 1 X 2  (SEQ ID NO: 1). 
     
     
         3 . The method as recited in  claim 1 , wherein the mature strand consists of UCAGCUGGCCCUCAUUUCX 1 X 2  (SEQ ID NO: 1). 
     
     
         4 . The method as recited in  claim 3 , wherein the passenger strand consists of GAAAUCAGGGCCAGCUUAX 2 X 1  (SEQ ID NO: 2). 
     
     
         5 . A duplex micro-ribonucleic acid (miRNA) composition comprising:
 a mature strand comprising a primary structure selected from the group consisting of:   
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 1) 
                 
                     
                   UCAGCUGGCCCUCAUUUCX 1 X 2 , 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 3) 
                 
                     
                   GGUCCAGAGGGGAGAUAGGUUCCUX 1 X 2 , 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 5) 
                 
                     
                   UGGCUCAGUUCAGCAGGAACAGUCX 1 X 2 , 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 7) 
                 
                     
                   UCUGCAGGGUUUGCUUUGAGX 1 X 2 , 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 9) 
                 
                     
                   UUUGAGGCUACAGUGAGAUGUGCAX 1 X 2 ; 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
         
           wherein a X 1  and X 2  are each independently selected from A, G, C, or T to define a first overhang with at least two residues that include X 1  and X 2  and less than five residues, wherein the mature strand has fewer than thirty residues, the mature strand having a 3′ end; 
         
         a passenger strand having fewer than thirty residues including a second overhang of between two and seven residues, the passenger strand being hydrogen bonded to the mature strand, the passenger strand being at least 80% complementary, but less than 100% complementary with respect to the mature strand such that there is at least one mismatch. 
       
     
     
         6 . The duplex micro-ribonucleic acid (miRNA) composition as recited in  claim 5 , further comprising biotin bound to the 3′ end of the mature strand. 
     
     
         7 . The duplex micro-ribonucleic acid (miRNA) composition as recited in  claim 5 , wherein the mature strand comprises UCAGCUGGCCCUCAUUUCX 1 X 2  (SEQ ID NO: 1). 
     
     
         8 . The duplex micro-ribonucleic acid (miRNA) composition as recited in  claim 5 , wherein the mature strand consists UCAGCUGGCCCUCAUUUCX 1 X 2  (SEQ ID NO: 1). 
     
     
         9 . The duplex micro-ribonucleic acid (miRNA) composition as recited in  claim 8 , further comprising biotin bound to the 3′ end of the mature strand. 
     
     
         10 . The duplex micro-ribonucleic acid (miRNA) composition as recited in  claim 5 , wherein the first overhang consists of two residues that are X 1  and X 2  and the second overhang consists of two residues. 
     
     
         11 . The duplex micro-ribonucleic acid (miRNA) composition as recited in  claim 5 , wherein the passenger strand and the mature strand each have fewer than twenty-five residues.

Join the waitlist — get patent alerts

Track US2019085330A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.