Method for treating schizophrenia

Abstract

The invention is directed to a method for treating the 22q11 deletion syndrome (22q11 DS) and schizophrenia (SCZ) by replenishment of decreased levels of miR-338-3p in thalamic neurons.

1 - 41 . (canceled) 
     
     
         42 . A kit for determining the likelihood of developing a positive symptom of schizophrenia and/or for determining efficacy of a treatment for schizophrenia or 22q11 deletion syndrome comprising a primer or a probe specific for miR-338-3p, and optionally further comprising instructions for use. 
     
     
         42 - 48 . (canceled) 
     
     
         49 . A pharmaceutical composition comprising miR-338-3p or a mimic or a functional derivative thereof and a pharmaceutically acceptable carrier or excipient. 
     
     
         50 - 51 . (canceled) 
     
     
         52 . A pharmaceutical dosage form comprising miR-338-3p or a mimic or a functional derivative thereof and a pharmaceutically acceptable carrier or excipient. 
     
     
         53 - 54 . (canceled) 
     
     
         55 . The kit of  claim 42 , further comprising miRNA isolation and/or purification means. 
     
     
         56 . The kit of  claim 42 , wherein the primer or the probe comprises a sequence that is at least 70% complementary to the sequence UCCAGCAUCAGUGAUUUUGUUG (SEQ ID NO: 1). 
     
     
         57 . The pharmaceutical composition of  claim 49 , wherein the functional derivative of miR-338-3p is a functional fragment of miR-338-3p or a variant thereof. 
     
     
         58 . The pharmaceutical composition of  claim 49 , wherein the miR-338-3p or the mimic or the functional derivative thereof is at least 7 nucleotides in length. 
     
     
         59 . The pharmaceutical composition of  claim 49 , wherein the miR-338-3p or the mimic or the functional derivative thereof comprises a sequence that has at least 70% sequence identity to the sequence UCCAGCAUCAGUGAUUUUGUUG (SEQ ID NO: 1). 
     
     
         60 . The pharmaceutical composition of  claim 49 , wherein the miR-338-3p or the mimic or the functional derivative thereof comprises one or more modifications selected from modifications to the base moiety, modifications to the sugar moiety, modifications to the phosphate moiety, modifications to the phosphate-sugar backbone, or any combination thereof. 
     
     
         61 . The pharmaceutical composition of  claim 49 , wherein the miR-338-3p or the mimic or the functional derivative thereof comprises a locked nucleic acid (LNA). 
     
     
         62 . The pharmaceutical composition of  claim 49 , wherein said composition is suitable for an intranasal administration. 
     
     
         63 . The pharmaceutical composition of  claim 49 , wherein said composition is suitable for a systemic administration. 
     
     
         64 . The pharmaceutical composition of  claim 49 , wherein the composition is suitable for administration to the thalamus. 
     
     
         65 . The pharmaceutical dosage form of  claim 52 , wherein the functional derivative of miR-338-3p is a functional fragment of miR-338-3p or a variant thereof. 
     
     
         66 . The pharmaceutical dosage form of  claim 52 , wherein the miR-338-3p or the mimic or the functional derivative thereof is at least 7 nucleotides in length. 
     
     
         67 . The pharmaceutical dosage form of  claim 52 , wherein the miR-338-3p or the mimic or the functional derivative thereof comprises a sequence that has at least 70% sequence identity to the sequence UCCAGCAUCAGUGAUUUUGUUG (SEQ ID NO: 1). 
     
     
         68 . The pharmaceutical dosage form of  claim 52 , wherein the miR-338-3p or the mimic or the functional derivative thereof comprises one or more modifications selected from modifications to the base moiety, modifications to the sugar moiety, modifications to the phosphate moiety, modifications to the phosphate-sugar backbone, or any combination thereof. 
     
     
         69 . The pharmaceutical dosage form of  claim 52 , wherein the miR-338-3p or the mimic or the functional derivative thereof comprises a locked nucleic acid (LNA). 
     
     
         70 . The pharmaceutical dosage form of  claim 52 , wherein the dosage form is a spray.