Use of pirna-54265 in diagnosis, treatment, and prognostic evaluation of colorectal cancer

Abstract

The present invention relates to a marker piRNA-54265 and a method in diagnosis, treatment, and prognostic evaluation of colorectal cancer. The marker piRNA-54265 is capable of being used for diagnosing and/or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: (1) SEQ ID NO.29: tggaggtgatgaactgtctgagcctgacc; (2) SEQ ID NO.30: UGGAGGUGAUGAACUGUCUGAGCCUGACC; (3) SEQ ID NO.31: GGUCAGGCUCAGACAGUUCAUCACCUCCA; (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and (6) an expression vector containing the polynucleotide construct of (5). The method is used for diagnosing/screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient, evaluating a prognosis of a colorectal cancer patient or treating colorectal cancer.

What is claimed is: 
     
         1 . A marker piRNA-54265 capable of being used for diagnosing and/or treating colorectal cancer, wherein the marker piRNA-54265 is selected from any of molecules as follows: 
       
         
           
                 
                 
               
                     
                   (1) SEQ ID NO. 29: 
                 
                     
                   tggaggtgatgaactgtctgagcctgacc; 
                 
                     
                     
                 
                     
                   (2) SEQ ID NO. 30: 
                 
                     
                   UGGAGGUGAUGAACUGUCUGAGCCUGACC; 
                 
                     
                     
                 
                     
                   (3) SEQ ID NO. 31: 
                 
                     
                   GGUCAGGCUCAGACAGUUCAUCACCUCCA; 
                 
             
                
                
                
                
                
                
                
                
               
            
           
         
         (4) a piR-54265 variant and a piR-54265 derivative modified from the molecule shown in (1), (2) or (3) with a same function; 
         (5) a piR-54265 polynucleotide construct capable of down-regulating an amount of the piR-54265 in vivo after being introduced; and 
         (6) an expression vector containing the polynucleotide construct of (5). 
       
     
     
         2 . The marker piRNA-54265 according to  claim 1 , wherein the marker piRNA-54265 is used as a diagnostic marker, an early screening marker or a therapeutic target for colorectal cancer. 
     
     
         3 . The marker piRNA-54265 according to  claim 1 , wherein the marker piRNA-54265 is used as a chemosensitivity evaluation marker or a prognostic evaluation marker for a colorectal cancer patient. 
     
     
         4 . An expression inhibitor or a knockout reagent of the marker piRNA-54265 according to  claim 1 , wherein the expression inhibitor or the knockout reagent is used as a colorectal cancer therapeutic drug or as an ancillary drug for improving the chemotherapeutic effect of colorectal cancer. 
     
     
         5 . The expression inhibitor or the knockout reagent according to  claim 4 , wherein the colorectal cancer therapeutic drug or the ancillary drug is a drug capable of inhibiting proliferation, invasion and/or metastasis of colorectal cancer cells. 
     
     
         6 . A method for diagnosing/screening colorectal cancer, evaluating chemosensitivity of a colorectal cancer patient or evaluating a prognosis of a colorectal cancer patient, wherein the method comprises detecting an expression level of piRNA-54265 in a specimen of a subject under test, judging whether the subject suffers from the colorectal cancer or has a risk of suffering from the colorectal cancer according to the expression level of the piRNA-54265, and evaluating the chemosensitivity or the prognosis of the colorectal cancer patient. 
     
     
         7 . A method for treating colorectal cancer, wherein the method comprises performing gene therapy with piRNA-54265 as a target to inhibit or silence an expression of the piRNA-54265, so as to realize a purpose of treating or assisting in treating colorectal cancer. 
     
     
         8 . A piRNA-54265 detection primers combination for early screening, diagnosis, curative efficacy monitoring and/or prognosis evaluation of colorectal cancer, wherein the piRNA-54265 detection primers combination comprises primer pairs for specifically detecting piRNA-54265, each of the primer pairs comprises a forward primer and a reverse primer, and the forward primer is designed based on a sequence of the piRNA-54265, wherein U in the RNA sequence of the piRNA-54265 is changed to T, and sequentially comprising an amount of bases from a 5′-of the sequence, and shall comprising first five bases “TGGAG” at least. 
     
     
         9 . The piRNA-54265 detection primer combination according to  claim 8 , wherein the primer pairs is a piRNA-54265 stem-loop PCR primer pair, or a piRNA-54265 PolyA tailed PCR primer pair. 
     
     
         10 . The piRNA-54265 detection primer combination according to  claim 9 , wherein the piRNA-54265 stem-loop PCR primer pair is shown as SEQ ID NO.8/9, SEQ ID NO.10/9, SEQ ID NO.11/9, SEQ ID NO.12/13, SEQ ID NO.14/13, SEQ ID NO.15/13, SEQ ID NO.16/13, SEQ ID NO.17/13, SEQ ID NO.18/13, SEQ ID NO.19/13 or SEQ ID NO.20/13; and
 the piRNA-54265 PolyA tailed PCR primer pair is shown as SEQ ID NO.8/21, SEQ ID NO.10/21, SEQ ID NO.11/22, SEQ ID NO.12/22, SEQ ID NO.14/23, SEQ ID NO.15/22, SEQ ID NO.16/22, SEQ ID NO.17/22, SEQ ID NO.18/22, SEQ ID NO.19/22 or SEQ ID NO.20/22.   
     
     
         11 . The piRNA-54265 detection primer combination according to  claim 9 , wherein the forward primer and the reverse primer of the piRNA-54265 stem-loop PCR primer pair are respectively shown as SEQ ID NO.26 and SEQ ID NO.9; and the forward primer and the reverse primer of the piRNA-54265 PolyA tailed PCR primer pair are respectively shown as SEQ ID NO.26 and SEQ ID NO.22. 
     
     
         12 . The piRNA-54265 detection primer combination according to  claim 8 , further comprising a probe used cooperatively with the primer pairs. 
     
     
         13 . The piRNA-54265 detection primer combination according to  claim 12 , wherein the probe has a sequence shown as SEQ ID NO.27. 
     
     
         14 . The piRNA-54265 detection primer combination according to  claim 8 , further comprising a matched RNA reverse transcription primer for specimen to be detected. 
     
     
         15 . A piRNA-54265 detection kit used for early screening, diagnosis, curative efficacy monitoring and/or prognostic evaluation of colorectal cancer, comprising the piRNA-54265 detection primer combination according to  claim 8 . 
     
     
         16 . A piRNA-54265 detection kit used for early screening, diagnosis, curative efficacy monitoring and/or prognostic evaluation of colorectal cancer, comprising the piRNA-54265 detection primer combination according to  claim 9 . 
     
     
         17 . A piRNA-54265 detection kit used for early screening, diagnosis, curative efficacy monitoring and/or prognostic evaluation of colorectal cancer, comprising the piRNA-54265 detection primer combination according to  claim 10 . 
     
     
         18 . A piRNA-54265 detection kit used for early screening, diagnosis, curative efficacy monitoring and/or prognostic evaluation of colorectal cancer, comprising the piRNA-54265 detection primer combination according to  claim 11 . 
     
     
         19 . A piRNA-54265 detection kit used for early screening, diagnosis, curative efficacy monitoring and/or prognostic evaluation of colorectal cancer, comprising the probe according to  claim 12 . 
     
     
         20 . A piRNA-54265 detection kit used for early screening, diagnosis, curative efficacy monitoring and/or prognostic evaluation of colorectal cancer, comprising the probe according to  claim 13 .