Factor viii compositions and methods of making and using same

Abstract

The present invention relates to compositions comprising factor VIII coagulation factors linked to extended recombinant polypeptide (XTEN), isolated nucleic acids encoding the compositions and vectors and host cells containing the same, and methods of making and using such compositions in treatment of factor VIII-related diseases, disorders, and conditions.

1 . A recombinant factor VIII fusion protein comprising a factor VIII polypeptide and an extended recombinant polypeptide (XTEN),
 wherein the factor VIII polypeptide comprises an A1 domain including an a1 acidic spacer region, an A2 domain including an a2 acidic spacer region, an A3 domain including an a3 acidic spacer region, a C1 domain, a C2 domain and optionally all or a portion of a B domain, and   wherein the XTEN is linked to the factor VIII polypeptide:   (i) at the C-terminus of the factor VIII polypeptide; (ii) within the B domain of the factor VIII polypeptide if all or a portion of the B domain is present; (iii) within the A1 domain of the factor VIII polypeptide; (iv) within the A2 domain of the factor VIII polypeptide; (v) within the A3 domain of the factor VIII polypeptide; (vi) within the C1 domain of the factor VIII polypeptide; (vii) within the C2 domain of the factor VIII polypeptide; (viii) at the N-terminus of the factor VIII polypeptide, or (ix) between two domains of the factor VIII polypeptide; and   wherein when compared to a corresponding factor VIII protein not linked to an XTEN, the fusion protein (a) retains at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% 100%, 200%, 300%, 400%, or 500% of the procoagulant activity in an in vitro coagulation assay, or (b) exhibits reduced binding to an anti-factor VIII antibody in an in vitro binding assay.   
     
     
         2 . (canceled) 
     
     
         3 . The recombinant factor VIII fusion protein of  claim 1 , wherein the XTEN is linked to the factor VIII polypeptide at an insertion site selected from Table 5, Table 6, Table 7, Table 8, or Table 9. 
     
     
         4 . (canceled) 
     
     
         5 . The recombinant factor VIII fusion protein of  claim 1 , wherein the factor VIII polypeptide has at least about 80%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or about 100% sequence identity to a sequence selected from the group consisting of the sequences in Table 1, the sequence depicted in  FIG. 3 , and the sequence depicted in  FIG. 4 , when optimally aligned. 
     
     
         6 . (canceled) 
     
     
         7 . The recombinant factor VIII fusion protein of  claim 1 , wherein the comprising at least a second XTEN is linked to the factor VIII polypeptide within or optionally replacing the B domain of the factor VIII polypeptide. 
     
     
         8 . The recombinant factor VIII fusion protein of  claim 1 , wherein the factor VIII polypeptide comprises a B-domain deleted variant of human factor VIII, wherein the B-domain deletion starts from a first position at about amino acid residue number 741 to about 750 and ending at a second position at about amino acid residue number 1635 to about 1648 with reference to full-length human factor VIII sequence as set forth in  FIG. 3 . 
     
     
         9 . (canceled) 
     
     
         10 . The recombinant factor VIII fusion protein of  claim 1 , wherein the fusion protein has at least about 80%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or at least about 100% sequence identity compared to a sequence of comparable length selected from the group consisting of the sequences of Table 21, when optimally aligned. 
     
     
         11 - 13 . (canceled) 
     
     
         14 . The recombinant factor VIII fusion protein of  claim 1 , wherein the XTEN has at least about 80%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or about 100% sequence identity compared to an XTEN of comparable length selected from the group consisting of the sequences in Table 4, Table 13, Table 14, Table 15, Table 16, and Table 17, when optimally aligned. 
     
     
         15 - 30 . (canceled) 
     
     
         31 . A recombinant factor VIII fusion protein comprising: a first polypeptide comprising formula X: (A1)-a1-(A2)-a2-[B]; and a second polypeptide comprising formula XI: a3-(A3)-(C1)-(C2);
 wherein the first polypeptide and the second polypeptide are fused or exist as a heterodimer;   wherein, a) A1 is an A1 domain of factor VIII; b) A2 is an A2 domain of factor VIII; c) [B] is a B domain of factor VIII, a fragment thereof, or is deleted or optionally not present; d) A3 is an A3 domain of factor VIII; e) C1 is a C1 domain of factor VIII; f) C2 is a C2 domain of factor VIII; g) a1, a2, and a3 are acidic spacer regions;   wherein an XTEN is inserted into [B]; and   wherein when compared to a corresponding factor VIII protein not linked to an XTEN, the fusion protein retains at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% 100%, 200%, 300%, 400%, or 500% of the exhibits procoagulant activity in an in vitro coagulation assay.   
     
     
         32 . The recombinant factor VIII fusion protein of  claim 31 , wherein the first polypeptide and the second polypeptide form a single polypeptide chain comprising the formula (A1)-a1-(A2)-a2-[B]-[a3]-(A3)-(C1)-(C2). 
     
     
         33 - 54 . (canceled) 
     
     
         55 . The recombinant factor VIII fusion protein of  claim 31 , wherein the fusion protein exhibits a terminal half-life at least about 3 hours, or 4 hours, or 6 hours, or 12 hours, or 13 hours, or 14 hours, or 16 hours, or 24 hours, or 48 hours, or 72 hours, or 96 hours, or 120 hours, or 144 hours, or 7 days, or 14 days, or 21 days when administered to a subject. 
     
     
         56 - 72 . (canceled) 
     
     
         73 . The recombinant factor VIII fusion protein of  claim 31 , wherein the at least one XTEN has at least 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or about 100% sequence identity compared to a sequence selected from AE42_1, AE42_2, AE42_3, AG42_1, AG42_2, AG42_3, AG42_4, AE144_1A, AE144_2A, AE144_2B, AE144_3A, AE144_3B, AE144_4A, AE144_4B, AE144_5A, AE144_6B, AG144_1, AG144_2, AG144_A, AG144_B, AG144_C, AG144_F, AG144_3, AG144_4, AE288_1, AE288_2, AG288_1, and AG288_2. 
     
     
         74 - 85 . (canceled) 
     
     
         86 . The recombinant factor VIII fusion protein of  claim 1 , wherein the XTEN is linked to the factor VIII polypeptide at an insertion site selected form the group consisting of residue numbers 18-32, or 40, or 211-224, or 336-403, or 599, or 745-1640, or 1656-1728, or 1796-1804, or 1900-1912, or 2171-2332. 
     
     
         87 . A pharmaceutical composition comprising the recombinant factor VIII fusion protein of  claim 1  and a pharmaceutically acceptable carrier. 
     
     
         88 . A method of treating a coagulopathy in a subject, comprising administering to the subject a composition comprising an effective amount of the pharmaceutical composition of  claim 87 . 
     
     
         89 - 93 . (canceled) 
     
     
         94 . The method of  claim 88 , wherein said coagulopathy is hemophilia A. 
     
     
         95 - 99 . (canceled) 
     
     
         100 . A nucleic acid encoding the recombinant factor VIII fusion protein of  claim 1 , or the complement thereof. 
     
     
         101 . The nucleic acid of  claim 100 , further comprising a nucleic acid sequence encoding a signal peptide, wherein said sequence is ATGCAAATAGAGCTCTCCACCTGCTTCTTTCTGTGCCTTTTGCGATTCTGCTTTAGT (SEQ ID NO: 1613), or the complement thereof. 
     
     
         102 - 103 . (canceled) 
     
     
         104 . A method of producing the recombinant factor VIII fusion protein of  claim 1 , comprising:
 (a) providing a host cell comprising an expression vector comprising a nucleic acid encoding the fusion protein of  claim 1 ;   (b) culturing the host cell under conditions to effect production of the fusion protein; and   (c) recovering the fusion protein.   
     
     
         105 - 107 . (canceled)