Transgenic soybean plants and chromosomes

Abstract

Described herein are transgenic soybean chromosomes containing a recombinant DNA that transcribes to an RNA molecule that hybridizes to and forms a cleavage-resistant duplex with either a mature miR171 miRNA or a transcript of a target gene having a recognition site for a mature miR171 miRNA whereby the function of the miR171 miRNA is inhibited and thereby imparts enhanced agronomic traits to soybean plants such as increased pods per node, increased number of nodes, a decreased distance between nodes, and a twisted stem.

1 . A non-natural transgenic chromosome in a soybean plant cell,
 wherein the non-natural transgenic chromosome has a recombinant DNA construct comprising:   a DNA molecule that is transcribed to an RNA molecule that under physiological conditions in a soybean plant cell hybridizes to and forms a cleavage-resistant duplex with a transcript of a target gene having a recognition site for a mature miR171 miRNA,
 wherein said recognition site comprises nucleotides complementary to nucleotides of said mature miR171 miRNA, 
 whereby the function of said mature miR171 miRNA is inhibited in said soybean plant cell, and 
   wherein said soybean plant cell is in a non-natural, transgenic soybean plant having enhanced agronomic characteristics selected from a group consisting of increased pods per node, increased number of internodes and nodes, decreased average internode length, and a twisted stem phenotype as compared to a control.   
     
     
         2 . The non-natural transgenic chromosome of  claim 1 ,
 wherein the mature miR171 miRNA has a consensus RNA nucleotide sequence of   
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 91) 
                 
                     
                   UGAUUGAGCCGCGCCAAUAUC 
                 
                     
                   or of 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 92) 
                 
                     
                   UUGAGCCGNGCCAAUAUCACN, 
                 
                     
                   and 
                 
             
                
                
                
                
                
                
                
               
            
           
         
         wherein the sequence of the mature miR171 miRNA has:
 (a) up to 6 nucleotide mismatches with one of the consensus RNA nucleotide sequence that best aligns with the sequence of the mature miR171 miRNA and 
 (b) up to two nucleotide additions or up to 2 nucleotide deletions at the 5′ terminus, the 3′ terminus or both the 3′ and 5′ termini of the mature miR171 miRNA. 
 
       
     
     
         3 . The non-natural transgenic chromosome of  claim 1 , wherein the mature miR171 miRNA has an RNA nucleotide sequence selected from the group consisting of SEQ ID NO: 17 through SEQ ID NO: 90. 
     
     
         4 - 7 . (canceled) 
     
     
         8 . The non-natural transgenic chromosome of  claim 1 , wherein said RNA molecule hybridizes to and forms a cleavage-resistant duplex with said transcript of a target gene at or in the vicinity of said recognition site for a mature miR171 miRNA. 
     
     
         9 . The non-natural transgenic chromosome of  claim 8 , wherein the length of said cleavage-resistant duplex comprises at least 10 base pairs. 
     
     
         10 . The non-natural transgenic chromosome of  claim 9 , wherein said cleavage-resistant duplex is formed at least partially within the recognition site. 
     
     
         11 . The non-natural transgenic chromosome of  claim 10 , wherein said cleavage-resistant duplex comprises at least 6 base pairs in said recognition site. 
     
     
         12 . The non-natural transgenic chromosome of  claim 8 , wherein said cleavage-resistant duplex between said RNA molecule and said transcript of a target gene includes at least one mismatch at the cleavage site of said mature miR171 miRNA. 
     
     
         13 . The non-natural transgenic chromosome of  claim 8 , wherein said cleavage-resistant duplex comprises:
 a. at least one mismatch between said RNA molecule and said recognition site corresponding to positions 9, 10, 11 or 12 within said mature miR171 miRNA , or   b. at least one insertion at a position in said RNA molecule corresponding to positions 10-12 within said mature miR171 miRNA , or   
       c. a mismatch at a position corresponding to the 3′ end of the recognition site. 
     
     
         14 . The non-natural transgenic chromosome of  claim 1 , wherein the RNA molecule has an RNA nucleotide sequence selected from the group consisting of SEQ ID NO: 93 through SEQ ID NO: 118 and SEQ ID NO: 119 through SEQ ID NO: 143. 
     
     
         15 . An industrial raw material including non-natural transgenic chromosomes of  claim 1 . 
     
     
         16 . The industrial raw material of  claim 15 , wherein non-natural transgenic chromosomes are in crushed soybean seeds. 
     
     
         17 . A non-natural transgenic soybean plant having a non-natural transgenic chromosome of  claim 1 . 
     
     
         18 . A non-natural transgenic soybean seed having a non-natural transgenic chromosome of  claim 1 . 
     
     
         19 . A non-natural transgenic soybean cell having a non-natural transgenic chromosome of  claim 1 . 
     
     
         20 . A dead non-natural transgenic soybean plant having mature bean pods containing non-natural, transgenic soybean seeds having a non-natural transgenic chromosome of  claim 1 . 
     
     
         21 . A method of increasing pods per node, number of internodes and nodes or a twisted stem in a soybean plant by providing in the soybean plant a non-natural transgenic chromosome of  claim 1 .