Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

1 - 2 . (canceled) 
     
     
         3 . A method of producing a modified eukaryotic cell, the method comprising introducing into a eukaryotic cell:
 (a) a DNA-targeting RNA, or a nucleic acid encoding the DNA-targeting RNA, where in the DNA-targeting RNA comprises:
 a DNA-targeting segment comprising a targeting sequence that is complementary to and hybridizes with a target sequence of the eukaryotic cell's chromosomal DNA, and 
 a protein-binding segment comprising a double-stranded RNA duplex; and 
   (b) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the nucleotide sequence encoding the Cas9 protein is modified to replace one or more codons of a wild-type nucleotide sequence with one or more different codons encoding the same amino acid,   wherein the Cas9 protein comprises the amino acid sequence set forth in SEQ ID NO: 2 and comprises, conjugated to the C-terminus, a Protein Transduction Domain (PTD) that aids in traversal of the Cas9 protein from the eukaryotic cell's cytosol to within an organelle, and   wherein the DNA-targeting RNA forms a complex with the Cas9 protein, and the Cas9 protein cleaves the eukaryotic cell's chromosomal DNA in a site specific manner, thereby producing a modified eukaryotic cell.   
     
     
         4 . The method of  claim 3 , wherein the eukaryotic cell is a mammalian cell. 
     
     
         5 . The method of  claim 3 , wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         6 . The method of  claim 3 , wherein the targeting sequence of the DNA-targeting RNA is 20 nucleotides (nt) long and the DNA-targeting RNA comprises, in 5′ to 3′ order:
 the 20 nt targeting sequence; and 
 the 42 nt sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 1360). 
 
     
     
         7 . The method of  claim 3 , wherein the targeting sequence of the DNA-targeting RNA is 20 nucleotides long and the DNA-targeting RNA comprises, in 5′ to 3′ order:
 the 20 nucleotide (nt) targeting sequence; 
 the 12 nt crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), 
 the 4 nt linker sequence GAAA, and 
 the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO: 432). 
 
     
     
         8 . The method of  claim 3 , wherein the eukaryotic cell is a human cell. 
     
     
         9 . The method of  claim 3 , comprising introducing into the eukaryotic cell: two or more DNA-targeting RNAs or nucleic acids encoding said two or more DNA-targeting RNAs, wherein the targeting sequence of each of said two or more DNA-targeting RNAs is complementary to and hybridizes with a different target sequence on the eukaryotic cell's chromosomal DNA. 
     
     
         10 . The method of  claim 9 , wherein the targeting sequence of each of said two or more DNA-targeting RNAs is 20 nucleotides (nt) long and said two or more DNA-targeting RNAs comprise, in 5′ to 3′ order:
 the 20 nt targeting sequence; 
 the 12 nt crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), 
 the 4 nt linker sequence GAAA, and 
 the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO: 432). 
 
     
     
         11 . The method of  claim 9 , wherein the eukaryotic cell is a human cell. 
     
     
         12 . A method of deleting sequence from a target DNA in a human cell, the method comprising introducing into a human cell:
 (a) DNA-targeting RNAs or nucleic acids encoding said DNA-targeting RNAs, wherein each of said DNA-targeting RNAs comprises a targeting sequence that is complementary to and hybridizes with a different target sequence within a target DNA in the human cell; and   (b) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the nucleotide sequence encoding the Cas9 protein is modified to replace one or more codons of a wild-type nucleotide sequence with one or more different codons encoding the same amino acid,   wherein the Cas9 protein comprises the amino acid sequence set forth in SEQ ID NO: 2 and comprises, conjugated to the C-terminus, a Protein Transduction Domain (PTD) that aids in traversal of the Cas9 protein from the human cell's cytosol to within an organelle, and   wherein the Cas9 protein: interacts with the DNA-targeting RNAs, is thereby guided to the different target sequences within the target DNA, and cleaves the target DNA, thereby resulting in deletion of sequence from the target DNA.   
     
     
         13 . The method of  claim 12 , wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         14 . The method of  claim 12 , wherein the targeting sequence of the DNA-targeting RNA is 20 nucleotides (nt) long and the DNA-targeting RNA comprises, in 5′ to 3′ order:
 the 20 nt targeting sequence; and 
 the 42 nt sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 1360). 
 
     
     
         15 . The method of  claim 12 , wherein the targeting sequence of each of said DNA-targeting RNAs is 20 nucleotides (nt) long and the DNA-targeting RNAs comprise, in 5′ to 3′ order:
 the 20 nt targeting sequence; 
 the 12 nt crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), 
 the 4 nt linker sequence GAAA, and 
 the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO: 432). 
 
     
     
         16 . The method of  claim 12 , wherein the human cell is a human stem cell. 
     
     
         17 . The method of  claim 12 , wherein the human cell is a human induced pluripotent stem cell. 
     
     
         18 . The method of  claim 12 , wherein said DNA-targeting RNAs are single-molecule DNA-targeting RNAs. 
     
     
         19 . A method of editing two or more sequences of chromosomal DNA in a human cell, the method comprising introducing into a human cell:
 (a) DNA-targeting RNAs or nucleic acids encoding said DNA-targeting RNAs, wherein each of said DNA-targeting RNAs comprises a targeting sequence that is complementary to and hybridizes with a different target sequence within the human cell's chromosomal DNA; and   (b) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the nucleotide sequence encoding the Cas9 protein is modified to replace one or more codons of a wild-type nucleotide sequence with one or more different codons encoding the same amino acid,   wherein the Cas9 protein comprises the amino acid sequence set forth in SEQ ID NO: 2 and comprises, conjugated to the C-terminus, a Protein Transduction Domain (PTD) that aids in traversal of the Cas9 protein from the human cell's cytosol to within an organelle, and   wherein the Cas9 protein: interacts with the DNA-targeting RNAs, is thereby guided to the different target sequences within the human cell's chromosomal DNA, and cleaves the human cell's chromosomal DNA, thereby resulting in modification of the human cell's chromosomal DNA.   
     
     
         20 . The method of  claim 19 , wherein said introducing results in deletion of chromosomal DNA sequence that intervenes between two target sequences that hybridize with said DNA-targeting RNAs. 
     
     
         21 . The method of  claim 19 , wherein the human cell is a human stem cell. 
     
     
         22 . The method of  claim 19 , wherein the targeting sequence of the DNA-targeting RNA is 20 nucleotides (nt) long and the DNA-targeting RNA comprises, in 5′ to 3′ order:
 the 20 nt targeting sequence; and 
 the 42 nt sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 1360). 
 
     
     
         23 . The method of  claim 19 , wherein the targeting sequence of each of said DNA-targeting RNAs is 20 nucleotides (nt) long and the DNA-targeting RNAs comprise, in 5′ to 3′ order:
 the 20 nt targeting sequence; 
 the 12 nt crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), 
 the 4 nt linker sequence GAAA, and 
 the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO: 432). 
 
     
     
         24 . The method of  claim 19 , wherein said DNA-targeting RNAs are single-molecule DNA-targeting RNAs. 
     
     
         25 . A method of causing deletion or insertion in a target DNA in a human cell, the method comprising introducing into a human cell:
 (a) a DNA-targeting RNA, or a nucleic acid encoding the DNA-targeting RNA, where in the DNA-targeting RNA comprises:
 a DNA-targeting segment comprising a targeting sequence that is complementary to and hybridizes with a target sequence of a target DNA present in the human cell, and 
 a protein-binding segment comprising a double-stranded RNA duplex; and 
   (b) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the nucleotide sequence encoding the Cas9 protein is modified to replace one or more codons of a wild-type nucleotide sequence with one or more different codons encoding the same amino acid,   wherein the Cas9 protein comprises the amino acid sequence set forth in SEQ ID NO: 2 and comprises, conjugated to the C-terminus, a Protein Transduction Domain (PTD) that aids in traversal of the Cas9 protein from the human cell's cytosol to within an organelle, and   wherein the DNA-targeting RNA forms a complex with the Cas9 protein, and the Cas9 protein cleaves the target DNA in a site specific manner, thereby resulting in a deletion or insertion of sequence in the target DNA.   
     
     
         26 . The method of  claim 25 , comprising introducing into the human cell: two or more DNA-targeting RNAs or nucleic acids encoding said two or more DNA-targeting RNAs, wherein the targeting sequence of each of said two or more DNA-targeting RNAs is complementary to and hybridizes with a different target sequence. 
     
     
         27 . The method of  claim 25 , wherein the targeting sequence of the DNA-targeting RNA is 20 nucleotides (nt) long and the DNA-targeting RNA comprises, in 5′ to 3′ order:
 the 20 nt targeting sequence; and 
 the 42 nt sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 1360). 
 
     
     
         28 . The method of  claim 25 , wherein the targeting sequence of the DNA-targeting RNA is 20 nucleotides long and the DNA-targeting RNA comprises, in 5′ to 3′ order:
 the 20 nucleotide (nt) targeting sequence; 
 the 12 nt crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), 
 the 4 nt linker sequence GAAA, and 
 the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO: 432). 
 
     
     
         29 . The method of  claim 25 , wherein the DNA-targeting RNA is a single-molecule DNA-targeting RNA. 
     
     
         30 . The method of  claim 25 , wherein the human cell is a human stem cell. 
     
     
         31 . The method of  claim 25 , wherein the human cell is a human induced pluripotent stem cell. 
     
     
         32 . The method of  claim 25 , wherein said deletion or insertion results in a gene knockout. 
     
     
         33 . The method of  claim 26 , wherein said deletion or insertion results in a gene knockout. 
     
     
         34 . The method of  claim 27 , wherein said deletion or insertion results in a gene knockout. 
     
     
         35 . The method of  claim 28 , wherein said deletion or insertion results in a gene knockout. 
     
     
         36 . The method of  claim 29 , wherein said deletion or insertion results in a gene knockout. 
     
     
         37 . The method of  claim 30 , wherein said deletion or insertion results in a gene knockout. 
     
     
         38 . The method of  claim 12 , wherein said introducing results in deletion of DNA sequence that intervenes between two target sequences that hybridize with said DNA-targeting RNAs. 
     
     
         39 . The method of  claim 38 , wherein the targeting sequence of each of said DNA-targeting RNAs is 20 nucleotides (nt) long and the DNA-targeting RNAs comprise, in 5′ to 3′ order:
 the 20 nt targeting sequence; 
 the 12 nt crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), 
 the 4 nt linker sequence GAAA, and 
 the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO: 432). 
 
     
     
         40 . The method of  claim 38 , wherein the human cell is a human induced pluripotent stem cell. 
     
     
         41 . The method of  claim 38 , wherein said DNA-targeting RNAs are single-molecule DNA-targeting RNAs. 
     
     
         42 . The method of  claim 25 , further comprising introducing a donor polynucleotide into the human cell, wherein the method results in insertion of sequence of the donor polynucleotide into the target DNA. 
     
     
         43 . The method of  claim 26 , further comprising introducing a donor polynucleotide into the human cell, wherein the method results in insertion of sequence of the donor polynucleotide into the target DNA. 
     
     
         44 . The method of  claim 27 , further comprising introducing a donor polynucleotide into the human cell, wherein the method results in insertion of sequence of the donor polynucleotide into the target DNA. 
     
     
         45 . The method of  claim 28 , further comprising introducing a donor polynucleotide into the human cell, wherein the method results in insertion of sequence of the donor polynucleotide into the target DNA. 
     
     
         46 . The method of  claim 29 , further comprising introducing a donor polynucleotide into the human cell, wherein the method results in insertion of sequence of the donor polynucleotide into the target DNA. 
     
     
         47 . The method of  claim 30 , further comprising introducing a donor polynucleotide into the human cell, wherein the method results in insertion of sequence of the donor polynucleotide into the target DNA. 
     
     
         48 . The method of  claim 31 , further comprising introducing a donor polynucleotide into the human cell, wherein the method results in insertion of sequence of the donor polynucleotide into the target DNA.