Particles with RNA Cleaving Nucleobase Polymers and Uses for Managing Inflammatory Disorders

Abstract

This disclosure relates to nucleobase polymers useful for degrading GATA-3 mRNA. In certain embodiments, this disclosure relates to nucleobase polymers and nanoparticles conjugated to nucleobase polymers disclosed herein. In certain embodiments, the nucleobase polymers or nanoparticles can be used in methods of managing disorders associated with excessive GATA-3 expression in inflammatory disorders and respiratory disorders such as asthma.

What we claim is: 
     
         1 . A method of treating asthma comprising administering an effective amount of a nanoparticle coated with a nucleobase polymer comprising a sequence selected from SEQ ID NO: 1-49 to a subject in need thereof. 
     
     
         2 . The method of  claim 1  wherein the nucleobase polymer has SEQ ID NO: 10 (GGCTTATTCAGGCTAGCTACAACGAAGATGGGG). 
     
     
         3 . The method of  claim 1  wherein the nucleobase polymer has SEQ ID NO: 20 (ATTCCTTAAAGGCTAGCTACAACGATTCTTGGC). 
     
     
         4 . The method of  claim 1  wherein the nucleobase polymer has SEQ ID NO: 30 (TCTTTTCTTAGGCTAGCTACAACGATTTGGTGC). 
     
     
         5 . The method of  claim 1 , wherein administration is in combination with a second respiratory agent. 
     
     
         6 . The method of  claim 5 , wherein the second respiratory agent is a corticosteroid, bronchodilator, albuterol, ipratropium, or combinations thereof. 
     
     
         7 . The method of  claim 1 , wherein the subject is a human subject.