US2021130885A1PendingUtilityA1
Spatial mapping of nucleic acid sequence information
Est. expiryJul 27, 2035(~9 yrs left)· nominal 20-yr term from priority
Inventors:Alex SoLi LiuMin-Jui Richard ShenNeeraj SalathiaKathryn M. StephensAnne JagerTimothy WilsonJustin FullertonSean M. RamirezShannon K. KaplanRigo PantojaBala Murali VenkatesanSteven Modiano
C12Q 2565/519C12Q 2543/101C12Q 1/6837C12Q 2565/514C12Q 2539/115C12Q 2600/156C12Q 1/6816C12Q 2565/543C12Q 1/6874C12Q 1/6855
66
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
Presented are methods and compositions for spatial detection and analysis of nucleic acids in a tissue sample. The methods can enable the characterization of transcriptomes and/or genomic variations in tissues while preserving spatial information about the tissue.
Claims
exact text as granted — not AI-modified1 . A capture array for spatial detection and analysis of nucleic acids in a tissue sample, comprising a capture site comprising a pair of capture probes immobilized on a surface, wherein a first capture probe of the pair of capture probes comprises a first primer binding region and a spatial address region, and wherein a second capture probe of the pair of capture probes comprises a second primer binding region and a capture region.
2 . The capture array of claim 1 , wherein the first capture probe does not comprise a gene-specific region.
3 . The capture array of claim 2 , wherein the second capture probe does not comprise a spatial address region.
4 . The capture array of claim 1 , wherein the capture site is a plurality of capture sites.
5 . The capture array of claim 1 , wherein the pair of capture probes in a capture site is a plurality of pairs of capture probes.
6 . The capture array of claim 5 , wherein each first capture probe in the plurality of pairs of capture probes within the same capture site comprises the same spatial address sequence.
7 . The capture array of claim 5 , wherein the plurality of pairs of capture probes in different capture sites comprises a different spatial address sequence.
8 . The capture array of claim 5 , wherein one or more capture sites of the capture array have the same number of first capture probes and of second capture probes.
9 . The capture array of claim 5 , wherein one or more capture sites of the capture array have more first capture probes than second capture probes.
10 . The capture array of claim 5 , wherein one or more capture sites of the capture array have more second capture probes than first capture probes.
11 . The capture array of claim 1 , wherein the capture array is integrated into an electrophoresis system.
12 . The capture array of claim 11 , wherein each capture site is independently electrically addressable in the electrophoresis system.
13 . The capture array of claim 11 , wherein the capture site in the electrophoresis system is configured for transfer and capture of nucleic acids from a tissue sample such that diffusion of nucleic acids from the tissue sample and loss of nucleic acids between capture sites are substantially reduced relative to a passive nucleic acid transfer occurring under otherwise identical conditions by passive diffusion.
14 . The capture array of claim 1 , wherein the surface of the capture array is a planar surface.
15 . The capture array of claim 1 , wherein the surface of the capture array is a bead surface.
16 . The capture array of claim 1 , wherein the capture region in the second capture probe is a gene-specific capture region.
17 . The capture array of claim 16 , wherein the gene-specific capture region in the second capture probe comprises
5′ CAACGATCGTCGAAATTCGC[target primer] 3′
5′ [target primer] AGATCGGAAGAGCGTCGTGTA 3′
where [target primer] is a sequence which is complimentary to a target nucleic acid.
18 . The capture array of claim 1 , wherein the capture region in the second capture probe is a universal capture region.
19 . The capture array of claim 18 , wherein the universal capture region in the second capture probe comprises a random primer sequence.
20 . The capture array of claim 18 , wherein the capture region comprises a poly-T capture sequence.
21 . The capture array of claim 4 , wherein the spatial address region of the first probe comprises a sequence of nucleic acids unique to each capture site such that the spatial address region of each capture site of the plurality of capture sites is different relative to one another.
22 . The capture array of claim 4 , wherein the second probe is a same sequence at each of the plurality of capture sites.
23 . The capture array of claim 1 , wherein the capture region comprises a capture region sequence configured to hybridize to a target nucleic acid comprising a sequence complementary to the capture region sequence.Join the waitlist — get patent alerts
Track US2021130885A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.